Incidental Mutation 'R6256:Syf2'
ID 506101
Institutional Source Beutler Lab
Gene Symbol Syf2
Ensembl Gene ENSMUSG00000028821
Gene Name SYF2 homolog, RNA splicing factor (S. cerevisiae)
Synonyms mp29, 1110018L13Rik, Gcipip, p29, D4Bwg1551e, Cbpin, Ntc31
MMRRC Submission 044373-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6256 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 134930898-134937548 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 134934578 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 84 (K84N)
Ref Sequence ENSEMBL: ENSMUSP00000030622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030622]
AlphaFold Q9D198
Predicted Effect probably damaging
Transcript: ENSMUST00000030622
AA Change: K84N

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030622
Gene: ENSMUSG00000028821
AA Change: K84N

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
Pfam:SYF2 89 237 9.8e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156334
Meta Mutation Damage Score 0.1961 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that interacts with cyclin D-type binding-protein 1, which is thought to be a cell cycle regulator at the G1/S transition. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele fail to undergo normal gastrulation and exhibit complete embryonic lethality, severely impaired embryonic development, and abnormal cell cycle checkpoint function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A T 8: 72,451,428 Q361L probably damaging Het
Abca7 A G 10: 80,002,622 T577A probably damaging Het
Acad12 A T 5: 121,614,086 V54E probably benign Het
Ago4 A G 4: 126,520,226 Y91H probably damaging Het
Akr1b10 T C 6: 34,387,688 V28A probably damaging Het
Ccdc33 T A 9: 58,101,918 probably null Het
Ccdc7a T C 8: 128,935,593 probably null Het
Ces1f A T 8: 93,265,794 V343E probably damaging Het
Cftr T C 6: 18,274,661 L896P probably damaging Het
Csmd3 G A 15: 47,669,729 P2375S probably damaging Het
Dnajb14 G C 3: 137,908,362 A345P probably damaging Het
Dnajb14 C T 3: 137,908,363 A345V probably damaging Het
Dnase1 G A 16: 4,037,621 R24K probably benign Het
Dnmbp C T 19: 43,852,281 V560M probably damaging Het
Dopey2 T A 16: 93,807,214 I1981N possibly damaging Het
Eif3a A C 19: 60,771,026 S770A possibly damaging Het
Fbxl7 A T 15: 26,553,002 C60S probably benign Het
Fras1 A T 5: 96,733,843 D2478V possibly damaging Het
Hrnr A G 3: 93,322,611 D52G probably damaging Het
Jmjd1c T A 10: 67,220,408 L823M probably damaging Het
Kdm1a G T 4: 136,568,600 C172* probably null Het
Kdm6b C T 11: 69,406,729 E295K probably damaging Het
Mepe A T 5: 104,337,074 M27L probably benign Het
Mogat2 A T 7: 99,219,895 H305Q probably damaging Het
Mst1r T A 9: 107,917,266 Y1215N probably damaging Het
Muc5ac A T 7: 141,789,795 H48L possibly damaging Het
Myo7b T C 18: 31,983,695 D953G probably damaging Het
Ocel1 T C 8: 71,371,828 probably benign Het
Pcdhb6 A G 18: 37,335,925 D633G probably damaging Het
Ppm1l A G 3: 69,497,897 I176V probably benign Het
Sall3 C T 18: 80,969,861 R1120H possibly damaging Het
Sbf1 G A 15: 89,300,867 P1018S probably benign Het
Setbp1 T C 18: 78,857,257 Y1065C probably damaging Het
Slc25a2 T C 18: 37,637,723 probably null Het
Slc4a2 C A 5: 24,435,890 T729K probably damaging Het
Sptlc2 T C 12: 87,355,531 E207G probably damaging Het
Sult6b1 A T 17: 78,906,914 F27I probably benign Het
Tmem209 A T 6: 30,497,167 N183K probably benign Het
Tmem232 G T 17: 65,478,402 Q188K possibly damaging Het
Tomm70a A T 16: 57,152,692 T598S probably benign Het
Ttll13 A G 7: 80,258,304 T556A probably benign Het
Vmn2r120 A T 17: 57,524,700 L363* probably null Het
Xpo6 G T 7: 126,108,619 Q872K probably damaging Het
Xrra1 A C 7: 99,914,464 S553R probably damaging Het
Zfy1 A T Y: 738,765 V147E unknown Homo
Zfy2 T C Y: 2,116,267 I258V probably benign Homo
Other mutations in Syf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02207:Syf2 APN 4 134935052 splice site probably null
R0839:Syf2 UTSW 4 134936063 missense probably damaging 0.97
R1475:Syf2 UTSW 4 134935434 missense possibly damaging 0.52
R4673:Syf2 UTSW 4 134934493 missense probably damaging 1.00
R4954:Syf2 UTSW 4 134934972 nonsense probably null
R5309:Syf2 UTSW 4 134936069 missense probably benign 0.35
R8141:Syf2 UTSW 4 134936871 missense probably damaging 1.00
R8334:Syf2 UTSW 4 134931275 missense probably benign 0.16
R9266:Syf2 UTSW 4 134936010 missense possibly damaging 0.55
Z1176:Syf2 UTSW 4 134936964 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CATAAGACAGGGTCTGTGTGGG -3'
(R):5'- AGCGCTACCCACTGTACTAC -3'

Sequencing Primer
(F):5'- GTGTGGGTCCCTCTCCTG -3'
(R):5'- AGGAGTGACTCCTGTAACTC -3'
Posted On 2018-02-28