Incidental Mutation 'R6256:Kdm1a'
ID506102
Institutional Source Beutler Lab
Gene Symbol Kdm1a
Ensembl Gene ENSMUSG00000036940
Gene Namelysine (K)-specific demethylase 1A
SynonymsAof2, 1810043O07Rik, Kdm1, LSD1
MMRRC Submission 044373-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6256 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location136550540-136602723 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 136568600 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 172 (C172*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105847] [ENSMUST00000116273]
Predicted Effect probably null
Transcript: ENSMUST00000046846
AA Change: C268*
SMART Domains Protein: ENSMUSP00000035457
Gene: ENSMUSG00000036940
AA Change: C268*

DomainStartEndE-ValueType
low complexity region 47 80 N/A INTRINSIC
Pfam:SWIRM 85 173 1.1e-20 PFAM
Pfam:AlaDh_PNT_C 181 297 8.4e-8 PFAM
Pfam:FAD_binding_2 189 236 1.6e-6 PFAM
Pfam:Pyr_redox 189 237 6.5e-7 PFAM
Pfam:DAO 189 457 1.5e-9 PFAM
Pfam:NAD_binding_8 192 256 9e-16 PFAM
Pfam:Amino_oxidase 197 657 7e-133 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105847
AA Change: C381*
SMART Domains Protein: ENSMUSP00000101473
Gene: ENSMUSG00000036940
AA Change: C381*

DomainStartEndE-ValueType
low complexity region 7 40 N/A INTRINSIC
low complexity region 76 97 N/A INTRINSIC
low complexity region 139 172 N/A INTRINSIC
low complexity region 177 194 N/A INTRINSIC
Pfam:SWIRM 197 285 8.8e-21 PFAM
Pfam:FAD_binding_2 301 348 6e-6 PFAM
Pfam:Pyr_redox 301 349 3e-6 PFAM
Pfam:DAO 301 557 9.9e-9 PFAM
Pfam:NAD_binding_8 304 368 4e-15 PFAM
Pfam:Amino_oxidase 309 847 2e-133 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000116273
AA Change: C361*
SMART Domains Protein: ENSMUSP00000111977
Gene: ENSMUSG00000036940
AA Change: C361*

DomainStartEndE-ValueType
low complexity region 7 40 N/A INTRINSIC
low complexity region 76 97 N/A INTRINSIC
low complexity region 139 172 N/A INTRINSIC
Pfam:SWIRM 175 265 2.7e-21 PFAM
Pfam:Pyr_redox 281 327 5.5e-7 PFAM
Pfam:FAD_binding_2 281 328 5.3e-6 PFAM
Pfam:DAO 281 403 3.7e-8 PFAM
Pfam:NAD_binding_8 284 348 5.7e-16 PFAM
Pfam:Amino_oxidase 289 827 9.6e-166 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000155354
AA Change: C2*
SMART Domains Protein: ENSMUSP00000114268
Gene: ENSMUSG00000036940
AA Change: C2*

DomainStartEndE-ValueType
Pfam:Amino_oxidase 3 250 2.9e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170979
AA Change: C172*
SMART Domains Protein: ENSMUSP00000131385
Gene: ENSMUSG00000036940
AA Change: C172*

DomainStartEndE-ValueType
Pfam:SWIRM 1 77 2.5e-18 PFAM
Pfam:Pyr_redox_2 70 142 1.1e-7 PFAM
Pfam:AlaDh_PNT_C 85 195 7.8e-8 PFAM
Pfam:FAD_binding_2 93 140 1.7e-6 PFAM
Pfam:Pyr_redox 93 142 8.2e-7 PFAM
Pfam:DAO 93 319 2.8e-9 PFAM
Pfam:NAD_binding_8 96 160 9.8e-16 PFAM
Pfam:Amino_oxidase 101 313 5.1e-32 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein containing a SWIRM domain, a FAD-binding motif, and an amine oxidase domain. This protein is a component of several histone deacetylase complexes, though it silences genes by functioning as a histone demethylase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous disruption of this gene results in abnormal gastrulation and early embryonic lethality. Homozygotes lacking the neurospecific isoform are hypoexcitable and display decreased susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A T 8: 72,451,428 Q361L probably damaging Het
Abca7 A G 10: 80,002,622 T577A probably damaging Het
Acad12 A T 5: 121,614,086 V54E probably benign Het
Ago4 A G 4: 126,520,226 Y91H probably damaging Het
Akr1b10 T C 6: 34,387,688 V28A probably damaging Het
Ccdc33 T A 9: 58,101,918 probably null Het
Ccdc7a T C 8: 128,935,593 probably null Het
Ces1f A T 8: 93,265,794 V343E probably damaging Het
Cftr T C 6: 18,274,661 L896P probably damaging Het
Csmd3 G A 15: 47,669,729 P2375S probably damaging Het
Dnajb14 G C 3: 137,908,362 A345P probably damaging Het
Dnajb14 C T 3: 137,908,363 A345V probably damaging Het
Dnase1 G A 16: 4,037,621 R24K probably benign Het
Dnmbp C T 19: 43,852,281 V560M probably damaging Het
Dopey2 T A 16: 93,807,214 I1981N possibly damaging Het
Eif3a A C 19: 60,771,026 S770A possibly damaging Het
Fbxl7 A T 15: 26,553,002 C60S probably benign Het
Fras1 A T 5: 96,733,843 D2478V possibly damaging Het
Hrnr A G 3: 93,322,611 D52G probably damaging Het
Jmjd1c T A 10: 67,220,408 L823M probably damaging Het
Kdm6b C T 11: 69,406,729 E295K probably damaging Het
Mepe A T 5: 104,337,074 M27L probably benign Het
Mogat2 A T 7: 99,219,895 H305Q probably damaging Het
Mst1r T A 9: 107,917,266 Y1215N probably damaging Het
Muc5ac A T 7: 141,789,795 H48L possibly damaging Het
Myo7b T C 18: 31,983,695 D953G probably damaging Het
Ocel1 T C 8: 71,371,828 probably benign Het
Pcdhb6 A G 18: 37,335,925 D633G probably damaging Het
Ppm1l A G 3: 69,497,897 I176V probably benign Het
Sall3 C T 18: 80,969,861 R1120H possibly damaging Het
Sbf1 G A 15: 89,300,867 P1018S probably benign Het
Setbp1 T C 18: 78,857,257 Y1065C probably damaging Het
Slc25a2 T C 18: 37,637,723 probably null Het
Slc4a2 C A 5: 24,435,890 T729K probably damaging Het
Sptlc2 T C 12: 87,355,531 E207G probably damaging Het
Sult6b1 A T 17: 78,906,914 F27I probably benign Het
Syf2 A T 4: 134,934,578 K84N probably damaging Het
Tmem209 A T 6: 30,497,167 N183K probably benign Het
Tmem232 G T 17: 65,478,402 Q188K possibly damaging Het
Tomm70a A T 16: 57,152,692 T598S probably benign Het
Ttll13 A G 7: 80,258,304 T556A probably benign Het
Vmn2r120 A T 17: 57,524,700 L363* probably null Het
Xpo6 G T 7: 126,108,619 Q872K probably damaging Het
Xrra1 A C 7: 99,914,464 S553R probably damaging Het
Zfy1 A T Y: 738,765 V147E unknown Homo
Zfy2 T C Y: 2,116,267 I258V probably benign Homo
Other mutations in Kdm1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Kdm1a APN 4 136554247 missense probably damaging 1.00
IGL01106:Kdm1a APN 4 136572328 splice site probably benign
IGL01356:Kdm1a APN 4 136553891 missense probably damaging 1.00
IGL01886:Kdm1a APN 4 136561016 critical splice donor site probably null
IGL02605:Kdm1a APN 4 136551037 unclassified probably benign
IGL02885:Kdm1a APN 4 136552535 missense probably benign 0.00
Seven_falls UTSW 4 136568600 nonsense probably null
R0095:Kdm1a UTSW 4 136550894 missense probably benign 0.09
R0532:Kdm1a UTSW 4 136561066 missense probably damaging 1.00
R0553:Kdm1a UTSW 4 136555298 missense probably damaging 1.00
R3625:Kdm1a UTSW 4 136561108 missense possibly damaging 0.93
R4085:Kdm1a UTSW 4 136551962 nonsense probably null
R4285:Kdm1a UTSW 4 136582036 splice site probably null
R5118:Kdm1a UTSW 4 136557358 unclassified probably benign
R5493:Kdm1a UTSW 4 136557421 frame shift probably null
R5800:Kdm1a UTSW 4 136573070 splice site probably null
R5945:Kdm1a UTSW 4 136568701 splice site probably null
R6508:Kdm1a UTSW 4 136554310 missense probably damaging 1.00
R7243:Kdm1a UTSW 4 136551954 missense probably damaging 1.00
R7270:Kdm1a UTSW 4 136552527 missense probably damaging 0.97
R7723:Kdm1a UTSW 4 136557749 missense probably benign 0.06
R8391:Kdm1a UTSW 4 136553843 missense probably benign 0.45
R8698:Kdm1a UTSW 4 136559207 missense probably benign 0.00
X0066:Kdm1a UTSW 4 136559225 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCCTAGGCAGACATGTAAATTTG -3'
(R):5'- CACCAAGGCTGAATTTAGCAAG -3'

Sequencing Primer
(F):5'- GCAGACATGTAAATTTGCACATATAC -3'
(R):5'- CCAAGGCTGAATTTAGCAAGTTTTTG -3'
Posted On2018-02-28