Mutagenetix > Incidental Mutation

Incidental Mutation 'R6256:Slc4a2'

506103

Institutional Source

Beutler Lab

Gene Symbol

Slc4a2

Ensembl Gene

ENSMUSG00000028962

Gene Name

solute carrier family 4 (anion exchanger), member 2

Synonyms

B3RP, Ae2

MMRRC Submission

044373-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.620) question?

Stock #

R6256 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

24423837-24440950 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 24435890 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 729 (T729K)

Ref Sequence

ENSEMBL: ENSMUSP00000110699 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080067] [ENSMUST00000115043] [ENSMUST00000115047] [ENSMUST00000115049]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000080067
AA Change: T743K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000078972
Gene: ENSMUSG00000028962
AA Change: T743K

Domain	Start	End	E-Value	Type
low complexity region	93	110	N/A	INTRINSIC
low complexity region	112	135	N/A	INTRINSIC
low complexity region	138	151	N/A	INTRINSIC
low complexity region	169	178	N/A	INTRINSIC
low complexity region	200	216	N/A	INTRINSIC
low complexity region	296	313	N/A	INTRINSIC
Pfam:Band_3_cyto	348	616	4.7e-111	PFAM
Pfam:HCO3_cotransp	671	1165	1.7e-217	PFAM
transmembrane domain	1183	1200	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115043

SMART Domains

Protein: ENSMUSP00000110695
Gene: ENSMUSG00000028959

Domain	Start	End	E-Value	Type
low complexity region	23	34	N/A	INTRINSIC
low complexity region	180	194	N/A	INTRINSIC
low complexity region	238	249	N/A	INTRINSIC
Pfam:FAST_1	273	341	7.6e-24	PFAM
Pfam:FAST_2	349	440	6.9e-26	PFAM
Pfam:RAP	475	513	1.4e-8	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000115047
AA Change: T729K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000110699
Gene: ENSMUSG00000028962
AA Change: T729K

Domain	Start	End	E-Value	Type
low complexity region	79	96	N/A	INTRINSIC
low complexity region	98	121	N/A	INTRINSIC
low complexity region	124	137	N/A	INTRINSIC
low complexity region	155	164	N/A	INTRINSIC
low complexity region	186	202	N/A	INTRINSIC
low complexity region	282	299	N/A	INTRINSIC
Pfam:Band_3_cyto	334	602	7.2e-108	PFAM
Pfam:HCO3_cotransp	656	1151	1e-244	PFAM
transmembrane domain	1169	1186	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000115049
AA Change: T734K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000110701
Gene: ENSMUSG00000028962
AA Change: T734K

Domain	Start	End	E-Value	Type
low complexity region	84	101	N/A	INTRINSIC
low complexity region	103	126	N/A	INTRINSIC
low complexity region	129	142	N/A	INTRINSIC
low complexity region	160	169	N/A	INTRINSIC
low complexity region	191	207	N/A	INTRINSIC
low complexity region	287	304	N/A	INTRINSIC
Pfam:Band_3_cyto	339	607	7.3e-108	PFAM
Pfam:HCO3_cotransp	661	1156	1e-244	PFAM
transmembrane domain	1174	1191	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132505

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140722

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146765

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149537

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158071

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198786

Meta Mutation Damage Score

0.9333

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.5%

Validation Efficiency

99% (74/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the anion exchanger family of membrane transport proteins. The encoded protein regulates intracellular pH, biliary bicarbonate secretion, and chloride uptake. Reduced expression of this gene may be associated with primary biliary cirrhosis (PBC) in human patients, while differential expression of this gene may be associated with malignant hepatocellular carcinoma, colon and gastric cancers. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice carrying an isoform-specific allele display male infertility associated with disrupted spermiogenesis and germ cell apoptosis. Mice homozygous for a null allele display perinatal and postnatal lethality, loss of gastric acid secretion, failure of tooth eruption, aphagia, and deafness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030K09Rik	A	T	8: 72,451,428	Q361L	probably damaging	Het
Abca7	A	G	10: 80,002,622	T577A	probably damaging	Het
Acad12	A	T	5: 121,614,086	V54E	probably benign	Het
Ago4	A	G	4: 126,520,226	Y91H	probably damaging	Het
Akr1b10	T	C	6: 34,387,688	V28A	probably damaging	Het
Ccdc33	T	A	9: 58,101,918		probably null	Het
Ccdc7a	T	C	8: 128,935,593		probably null	Het
Ces1f	A	T	8: 93,265,794	V343E	probably damaging	Het
Cftr	T	C	6: 18,274,661	L896P	probably damaging	Het
Csmd3	G	A	15: 47,669,729	P2375S	probably damaging	Het
Dnajb14	G	C	3: 137,908,362	A345P	probably damaging	Het
Dnajb14	C	T	3: 137,908,363	A345V	probably damaging	Het
Dnase1	G	A	16: 4,037,621	R24K	probably benign	Het
Dnmbp	C	T	19: 43,852,281	V560M	probably damaging	Het
Dopey2	T	A	16: 93,807,214	I1981N	possibly damaging	Het
Eif3a	A	C	19: 60,771,026	S770A	possibly damaging	Het
Fbxl7	A	T	15: 26,553,002	C60S	probably benign	Het
Fras1	A	T	5: 96,733,843	D2478V	possibly damaging	Het
Hrnr	A	G	3: 93,322,611	D52G	probably damaging	Het
Jmjd1c	T	A	10: 67,220,408	L823M	probably damaging	Het
Kdm1a	G	T	4: 136,568,600	C172*	probably null	Het
Kdm6b	C	T	11: 69,406,729	E295K	probably damaging	Het
Mepe	A	T	5: 104,337,074	M27L	probably benign	Het
Mogat2	A	T	7: 99,219,895	H305Q	probably damaging	Het
Mst1r	T	A	9: 107,917,266	Y1215N	probably damaging	Het
Muc5ac	A	T	7: 141,789,795	H48L	possibly damaging	Het
Myo7b	T	C	18: 31,983,695	D953G	probably damaging	Het
Ocel1	T	C	8: 71,371,828		probably benign	Het
Pcdhb6	A	G	18: 37,335,925	D633G	probably damaging	Het
Ppm1l	A	G	3: 69,497,897	I176V	probably benign	Het
Sall3	C	T	18: 80,969,861	R1120H	possibly damaging	Het
Sbf1	G	A	15: 89,300,867	P1018S	probably benign	Het
Setbp1	T	C	18: 78,857,257	Y1065C	probably damaging	Het
Slc25a2	T	C	18: 37,637,723		probably null	Het
Sptlc2	T	C	12: 87,355,531	E207G	probably damaging	Het
Sult6b1	A	T	17: 78,906,914	F27I	probably benign	Het
Syf2	A	T	4: 134,934,578	K84N	probably damaging	Het
Tmem209	A	T	6: 30,497,167	N183K	probably benign	Het
Tmem232	G	T	17: 65,478,402	Q188K	possibly damaging	Het
Tomm70a	A	T	16: 57,152,692	T598S	probably benign	Het
Ttll13	A	G	7: 80,258,304	T556A	probably benign	Het
Vmn2r120	A	T	17: 57,524,700	L363*	probably null	Het
Xpo6	G	T	7: 126,108,619	Q872K	probably damaging	Het
Xrra1	A	C	7: 99,914,464	S553R	probably damaging	Het
Zfy1	A	T	Y: 738,765	V147E	unknown	Homo
Zfy2	T	C	Y: 2,116,267	I258V	probably benign	Homo

Other mutations in Slc4a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00704:Slc4a2	APN	5	24439068	missense	probably damaging	1.00
IGL00772:Slc4a2	APN	5	24435196	missense	probably damaging	1.00
IGL00897:Slc4a2	APN	5	24429559	nonsense	probably null
IGL01477:Slc4a2	APN	5	24430156	unclassified	probably benign
IGL01680:Slc4a2	APN	5	24432930	missense	probably benign	0.23
IGL01681:Slc4a2	APN	5	24434187	missense	probably damaging	1.00
IGL01808:Slc4a2	APN	5	24440207	missense	probably damaging	1.00
IGL02399:Slc4a2	APN	5	24434713	missense	probably damaging	1.00
IGL02501:Slc4a2	APN	5	24429434	missense	probably benign	0.00
IGL03214:Slc4a2	APN	5	24434881	missense	probably benign	0.01
R0238:Slc4a2	UTSW	5	24436274	splice site	probably null
R0238:Slc4a2	UTSW	5	24436274	splice site	probably null
R0309:Slc4a2	UTSW	5	24434346	missense	probably damaging	1.00
R0325:Slc4a2	UTSW	5	24435943	missense	probably damaging	1.00
R0656:Slc4a2	UTSW	5	24431259	missense	probably benign	0.05
R0755:Slc4a2	UTSW	5	24435577	missense	probably benign	0.07
R0946:Slc4a2	UTSW	5	24435886	missense	probably damaging	1.00
R1075:Slc4a2	UTSW	5	24439057	missense	possibly damaging	0.85
R1733:Slc4a2	UTSW	5	24429567	missense	probably damaging	1.00
R1794:Slc4a2	UTSW	5	24439328	missense	probably damaging	1.00
R1823:Slc4a2	UTSW	5	24427620	missense	probably damaging	0.99
R2048:Slc4a2	UTSW	5	24431559	missense	probably damaging	1.00
R2165:Slc4a2	UTSW	5	24431316	missense	probably damaging	1.00
R2181:Slc4a2	UTSW	5	24435653	missense	possibly damaging	0.80
R2405:Slc4a2	UTSW	5	24435601	missense	probably damaging	1.00
R3551:Slc4a2	UTSW	5	24430101	missense	probably benign	0.01
R4423:Slc4a2	UTSW	5	24439848	nonsense	probably null
R4457:Slc4a2	UTSW	5	24434330	unclassified	probably benign
R4678:Slc4a2	UTSW	5	24434240	critical splice donor site	probably null
R4730:Slc4a2	UTSW	5	24434880	missense	probably damaging	1.00
R4824:Slc4a2	UTSW	5	24440143	missense	probably damaging	1.00
R4928:Slc4a2	UTSW	5	24435342	critical splice donor site	probably null
R4993:Slc4a2	UTSW	5	24434869	missense	probably damaging	1.00
R5071:Slc4a2	UTSW	5	24438762	missense	probably benign
R5072:Slc4a2	UTSW	5	24438762	missense	probably benign
R5073:Slc4a2	UTSW	5	24438762	missense	probably benign
R5074:Slc4a2	UTSW	5	24438762	missense	probably benign
R5108:Slc4a2	UTSW	5	24439333	missense	probably damaging	1.00
R5135:Slc4a2	UTSW	5	24430127	missense	possibly damaging	0.78
R5349:Slc4a2	UTSW	5	24435635	missense	possibly damaging	0.74
R5601:Slc4a2	UTSW	5	24438774	missense	probably benign	0.07
R5666:Slc4a2	UTSW	5	24434838	missense	probably damaging	1.00
R5670:Slc4a2	UTSW	5	24434838	missense	probably damaging	1.00
R6861:Slc4a2	UTSW	5	24435009	missense	probably damaging	1.00
R7360:Slc4a2	UTSW	5	24429715	missense	probably benign	0.11
R7494:Slc4a2	UTSW	5	24432864	missense	possibly damaging	0.91
R7740:Slc4a2	UTSW	5	24431668	splice site	probably null
R8087:Slc4a2	UTSW	5	24438749	unclassified	probably benign
R8966:Slc4a2	UTSW	5	24430094	missense	probably benign
R9236:Slc4a2	UTSW	5	24439310	missense	probably benign
R9287:Slc4a2	UTSW	5	24434125	missense	probably damaging	1.00
R9430:Slc4a2	UTSW	5	24431319	missense	probably benign	0.09
R9492:Slc4a2	UTSW	5	24439763	missense	probably benign	0.11
R9661:Slc4a2	UTSW	5	24435007	missense	probably damaging	1.00
X0027:Slc4a2	UTSW	5	24435914	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- TGACTTCCGCGATGCACTTG -3'
(R):5'- TGCTACTGCAGAACTGAGTAG -3'

Sequencing Primer
(F):5'- ATGCACTTGACCCCCAGTG -3'
(R):5'- TGCTACTGCAGAACTGAGTAGGAAAG -3'

Posted On

2018-02-28