Incidental Mutation 'R6256:Mepe'
ID 506105
Institutional Source Beutler Lab
Gene Symbol Mepe
Ensembl Gene ENSMUSG00000053863
Gene Name matrix extracellular phosphoglycoprotein with ASARM motif (bone)
Synonyms OF45
MMRRC Submission 044373-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.049) question?
Stock # R6256 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 104473195-104486477 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 104484940 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 27 (M27L)
Ref Sequence ENSEMBL: ENSMUSP00000065200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066207]
AlphaFold Q8K4L6
Predicted Effect probably benign
Transcript: ENSMUST00000066207
AA Change: M27L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000065200
Gene: ENSMUSG00000053863
AA Change: M27L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Osteoregulin 29 192 4.2e-76 PFAM
low complexity region 257 272 N/A INTRINSIC
low complexity region 426 438 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted calcium-binding phosphoprotein that belongs to the small integrin-binding ligand, N-linked glycoprotein (SIBLING) family of proteins. Members of this family are components of the extracellular matrix of bone and dentin and regulate bone mineralization. Deficiency of a similar protein in mouse results in increased bone mass. Mice lacking this gene are resistant to aging-related trabecular bone loss. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene have increased amounts of trabecular bone in their skeleton and undergo less age related bone loss. Otherwise, they display a normal phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A T 8: 73,205,272 (GRCm39) Q361L probably damaging Het
Abca7 A G 10: 79,838,456 (GRCm39) T577A probably damaging Het
Acad12 A T 5: 121,752,149 (GRCm39) V54E probably benign Het
Ago4 A G 4: 126,414,019 (GRCm39) Y91H probably damaging Het
Akr1b10 T C 6: 34,364,623 (GRCm39) V28A probably damaging Het
Ccdc33 T A 9: 58,009,201 (GRCm39) probably null Het
Ccdc7a T C 8: 129,662,074 (GRCm39) probably null Het
Ces1f A T 8: 93,992,422 (GRCm39) V343E probably damaging Het
Cftr T C 6: 18,274,660 (GRCm39) L896P probably damaging Het
Csmd3 G A 15: 47,533,125 (GRCm39) P2375S probably damaging Het
Dnajb14 C T 3: 137,614,124 (GRCm39) A345V probably damaging Het
Dnajb14 G C 3: 137,614,123 (GRCm39) A345P probably damaging Het
Dnase1 G A 16: 3,855,485 (GRCm39) R24K probably benign Het
Dnmbp C T 19: 43,840,720 (GRCm39) V560M probably damaging Het
Dop1b T A 16: 93,604,102 (GRCm39) I1981N possibly damaging Het
Eif3a A C 19: 60,759,464 (GRCm39) S770A possibly damaging Het
Fbxl7 A T 15: 26,553,088 (GRCm39) C60S probably benign Het
Fras1 A T 5: 96,881,702 (GRCm39) D2478V possibly damaging Het
Hrnr A G 3: 93,229,918 (GRCm39) D52G probably damaging Het
Jmjd1c T A 10: 67,056,187 (GRCm39) L823M probably damaging Het
Kdm1a G T 4: 136,295,911 (GRCm39) C172* probably null Het
Kdm6b C T 11: 69,297,555 (GRCm39) E295K probably damaging Het
Mogat2 A T 7: 98,869,102 (GRCm39) H305Q probably damaging Het
Mst1r T A 9: 107,794,465 (GRCm39) Y1215N probably damaging Het
Muc5ac A T 7: 141,343,532 (GRCm39) H48L possibly damaging Het
Myo7b T C 18: 32,116,748 (GRCm39) D953G probably damaging Het
Ocel1 T C 8: 71,824,472 (GRCm39) probably benign Het
Pcdhb6 A G 18: 37,468,978 (GRCm39) D633G probably damaging Het
Ppm1l A G 3: 69,405,230 (GRCm39) I176V probably benign Het
Sall3 C T 18: 81,013,076 (GRCm39) R1120H possibly damaging Het
Sbf1 G A 15: 89,185,070 (GRCm39) P1018S probably benign Het
Setbp1 T C 18: 78,900,472 (GRCm39) Y1065C probably damaging Het
Slc25a2 T C 18: 37,770,776 (GRCm39) probably null Het
Slc4a2 C A 5: 24,640,888 (GRCm39) T729K probably damaging Het
Sptlc2 T C 12: 87,402,305 (GRCm39) E207G probably damaging Het
Sult6b1 A T 17: 79,214,343 (GRCm39) F27I probably benign Het
Syf2 A T 4: 134,661,889 (GRCm39) K84N probably damaging Het
Tmem209 A T 6: 30,497,166 (GRCm39) N183K probably benign Het
Tmem232 G T 17: 65,785,397 (GRCm39) Q188K possibly damaging Het
Tomm70a A T 16: 56,973,055 (GRCm39) T598S probably benign Het
Ttll13 A G 7: 79,908,052 (GRCm39) T556A probably benign Het
Vmn2r120 A T 17: 57,831,700 (GRCm39) L363* probably null Het
Xpo6 G T 7: 125,707,791 (GRCm39) Q872K probably damaging Het
Xrra1 A C 7: 99,563,671 (GRCm39) S553R probably damaging Het
Zfy1 A T Y: 738,765 (GRCm39) V147E unknown Homo
Zfy2 T C Y: 2,116,267 (GRCm39) I258V probably benign Homo
Other mutations in Mepe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Mepe APN 5 104,485,843 (GRCm39) missense probably damaging 1.00
IGL01896:Mepe APN 5 104,486,135 (GRCm39) missense possibly damaging 0.85
IGL01997:Mepe APN 5 104,485,466 (GRCm39) missense probably damaging 1.00
IGL02311:Mepe APN 5 104,485,571 (GRCm39) missense probably damaging 0.98
IGL02586:Mepe APN 5 104,485,316 (GRCm39) missense probably benign 0.39
F6893:Mepe UTSW 5 104,485,242 (GRCm39) missense possibly damaging 0.87
R1187:Mepe UTSW 5 104,486,114 (GRCm39) missense probably damaging 0.98
R1218:Mepe UTSW 5 104,474,939 (GRCm39) missense probably benign
R1633:Mepe UTSW 5 104,485,540 (GRCm39) missense probably benign 0.25
R2024:Mepe UTSW 5 104,474,957 (GRCm39) missense possibly damaging 0.72
R2026:Mepe UTSW 5 104,474,957 (GRCm39) missense possibly damaging 0.72
R2027:Mepe UTSW 5 104,474,957 (GRCm39) missense possibly damaging 0.72
R2393:Mepe UTSW 5 104,485,327 (GRCm39) missense possibly damaging 0.95
R2920:Mepe UTSW 5 104,486,113 (GRCm39) missense probably damaging 0.99
R3040:Mepe UTSW 5 104,485,988 (GRCm39) missense probably damaging 0.99
R3716:Mepe UTSW 5 104,485,294 (GRCm39) missense probably benign 0.25
R3973:Mepe UTSW 5 104,484,944 (GRCm39) missense probably benign
R3976:Mepe UTSW 5 104,484,944 (GRCm39) missense probably benign
R4894:Mepe UTSW 5 104,473,268 (GRCm39) missense probably damaging 0.98
R5556:Mepe UTSW 5 104,486,078 (GRCm39) missense probably damaging 1.00
R6788:Mepe UTSW 5 104,486,074 (GRCm39) nonsense probably null
R7361:Mepe UTSW 5 104,485,009 (GRCm39) missense probably benign 0.41
R8431:Mepe UTSW 5 104,486,047 (GRCm39) missense possibly damaging 0.91
R8679:Mepe UTSW 5 104,485,754 (GRCm39) missense possibly damaging 0.91
R8745:Mepe UTSW 5 104,485,525 (GRCm39) missense possibly damaging 0.93
R8817:Mepe UTSW 5 104,485,151 (GRCm39) missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TCCATCCCTATTGAGTTGTAGAC -3'
(R):5'- TGATATTTCTGAGGAGGGCAGC -3'

Sequencing Primer
(F):5'- CATCCCTATTGAGTTGTAGACTTTAC -3'
(R):5'- AGCACCATACCTGTCCTGG -3'
Posted On 2018-02-28