Incidental Mutation 'R6256:Mepe'
ID506105
Institutional Source Beutler Lab
Gene Symbol Mepe
Ensembl Gene ENSMUSG00000053863
Gene Namematrix extracellular phosphoglycoprotein with ASARM motif (bone)
SynonymsOF45
MMRRC Submission 044373-MU
Accession Numbers

Genbank: NM_053172; MGI: 2137384

Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R6256 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location104325329-104338611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104337074 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 27 (M27L)
Ref Sequence ENSEMBL: ENSMUSP00000065200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066207]
Predicted Effect probably benign
Transcript: ENSMUST00000066207
AA Change: M27L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000065200
Gene: ENSMUSG00000053863
AA Change: M27L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Osteoregulin 29 192 4.2e-76 PFAM
low complexity region 257 272 N/A INTRINSIC
low complexity region 426 438 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted calcium-binding phosphoprotein that belongs to the small integrin-binding ligand, N-linked glycoprotein (SIBLING) family of proteins. Members of this family are components of the extracellular matrix of bone and dentin and regulate bone mineralization. Deficiency of a similar protein in mouse results in increased bone mass. Mice lacking this gene are resistant to aging-related trabecular bone loss. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene have increased amounts of trabecular bone in their skeleton and undergo less age related bone loss. Otherwise, they display a normal phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A T 8: 72,451,428 Q361L probably damaging Het
Abca7 A G 10: 80,002,622 T577A probably damaging Het
Acad12 A T 5: 121,614,086 V54E probably benign Het
Ago4 A G 4: 126,520,226 Y91H probably damaging Het
Akr1b10 T C 6: 34,387,688 V28A probably damaging Het
Ccdc33 T A 9: 58,101,918 probably null Het
Ccdc7a T C 8: 128,935,593 probably null Het
Ces1f A T 8: 93,265,794 V343E probably damaging Het
Cftr T C 6: 18,274,661 L896P probably damaging Het
Csmd3 G A 15: 47,669,729 P2375S probably damaging Het
Dnajb14 G C 3: 137,908,362 A345P probably damaging Het
Dnajb14 C T 3: 137,908,363 A345V probably damaging Het
Dnase1 G A 16: 4,037,621 R24K probably benign Het
Dnmbp C T 19: 43,852,281 V560M probably damaging Het
Dopey2 T A 16: 93,807,214 I1981N possibly damaging Het
Eif3a A C 19: 60,771,026 S770A possibly damaging Het
Fbxl7 A T 15: 26,553,002 C60S probably benign Het
Fras1 A T 5: 96,733,843 D2478V possibly damaging Het
Hrnr A G 3: 93,322,611 D52G probably damaging Het
Jmjd1c T A 10: 67,220,408 L823M probably damaging Het
Kdm1a G T 4: 136,568,600 C172* probably null Het
Kdm6b C T 11: 69,406,729 E295K probably damaging Het
Mogat2 A T 7: 99,219,895 H305Q probably damaging Het
Mst1r T A 9: 107,917,266 Y1215N probably damaging Het
Muc5ac A T 7: 141,789,795 H48L possibly damaging Het
Myo7b T C 18: 31,983,695 D953G probably damaging Het
Ocel1 T C 8: 71,371,828 probably benign Het
Pcdhb6 A G 18: 37,335,925 D633G probably damaging Het
Ppm1l A G 3: 69,497,897 I176V probably benign Het
Sall3 C T 18: 80,969,861 R1120H possibly damaging Het
Sbf1 G A 15: 89,300,867 P1018S probably benign Het
Setbp1 T C 18: 78,857,257 Y1065C probably damaging Het
Slc25a2 T C 18: 37,637,723 probably null Het
Slc4a2 C A 5: 24,435,890 T729K probably damaging Het
Sptlc2 T C 12: 87,355,531 E207G probably damaging Het
Sult6b1 A T 17: 78,906,914 F27I probably benign Het
Syf2 A T 4: 134,934,578 K84N probably damaging Het
Tmem209 A T 6: 30,497,167 N183K probably benign Het
Tmem232 G T 17: 65,478,402 Q188K possibly damaging Het
Tomm70a A T 16: 57,152,692 T598S probably benign Het
Ttll13 A G 7: 80,258,304 T556A probably benign Het
Vmn2r120 A T 17: 57,524,700 L363* probably null Het
Xpo6 G T 7: 126,108,619 Q872K probably damaging Het
Xrra1 A C 7: 99,914,464 S553R probably damaging Het
Zfy1 A T Y: 738,765 V147E unknown Homo
Zfy2 T C Y: 2,116,267 I258V probably benign Homo
Other mutations in Mepe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Mepe APN 5 104337977 missense probably damaging 1.00
IGL01896:Mepe APN 5 104338269 missense possibly damaging 0.85
IGL01997:Mepe APN 5 104337600 missense probably damaging 1.00
IGL02311:Mepe APN 5 104337705 missense probably damaging 0.98
IGL02586:Mepe APN 5 104337450 missense probably benign 0.39
F6893:Mepe UTSW 5 104337376 missense possibly damaging 0.87
R1187:Mepe UTSW 5 104338248 missense probably damaging 0.98
R1218:Mepe UTSW 5 104327073 missense probably benign
R1633:Mepe UTSW 5 104337674 missense probably benign 0.25
R2024:Mepe UTSW 5 104327091 missense possibly damaging 0.72
R2026:Mepe UTSW 5 104327091 missense possibly damaging 0.72
R2027:Mepe UTSW 5 104327091 missense possibly damaging 0.72
R2393:Mepe UTSW 5 104337461 missense possibly damaging 0.95
R2920:Mepe UTSW 5 104338247 missense probably damaging 0.99
R3040:Mepe UTSW 5 104338122 missense probably damaging 0.99
R3716:Mepe UTSW 5 104337428 missense probably benign 0.25
R3973:Mepe UTSW 5 104337078 missense probably benign
R3976:Mepe UTSW 5 104337078 missense probably benign
R4894:Mepe UTSW 5 104325402 missense probably damaging 0.98
R5556:Mepe UTSW 5 104338212 missense probably damaging 1.00
R6788:Mepe UTSW 5 104338208 nonsense probably null
R7361:Mepe UTSW 5 104337143 missense probably benign 0.41
R8431:Mepe UTSW 5 104338181 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TCCATCCCTATTGAGTTGTAGAC -3'
(R):5'- TGATATTTCTGAGGAGGGCAGC -3'

Sequencing Primer
(F):5'- CATCCCTATTGAGTTGTAGACTTTAC -3'
(R):5'- AGCACCATACCTGTCCTGG -3'
Posted On2018-02-28