Mutagenetix > Incidental Mutation

Incidental Mutation 'R6256:Cftr'

506107

Institutional Source

Beutler Lab

Gene Symbol

Cftr

Ensembl Gene

ENSMUSG00000041301

Gene Name

cystic fibrosis transmembrane conductance regulator

Synonyms

Abcc7

MMRRC Submission

044373-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.226) question?

Stock #

R6256 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

18170687-18322768 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 18274661 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 896 (L896P)

Ref Sequence

ENSEMBL: ENSMUSP00000111065 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045706] [ENSMUST00000115405] [ENSMUST00000115406] [ENSMUST00000140407]

AlphaFold

P26361

Predicted Effect

probably damaging
Transcript: ENSMUST00000045706
AA Change: L926P

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000049228
Gene: ENSMUSG00000041301
AA Change: L926P

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	81	350	3.7e-40	PFAM
AAA	450	623	2.16e-12	SMART
Pfam:CFTR_R	639	844	2e-93	PFAM
Pfam:ABC_membrane	857	1142	2.7e-53	PFAM
AAA	1232	1414	9.94e-12	SMART
low complexity region	1465	1474	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115405

SMART Domains

Protein: ENSMUSP00000111064
Gene: ENSMUSG00000041301

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	81	350	1.4e-48	PFAM
Pfam:ABC_tran	441	570	2.3e-19	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000115406
AA Change: L896P

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000111065
Gene: ENSMUSG00000041301
AA Change: L896P

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	81	167	4e-14	PFAM
Pfam:ABC_membrane	162	320	2.5e-20	PFAM
AAA	420	593	2.16e-12	SMART
Pfam:CFTR_R	609	815	1.3e-97	PFAM
Pfam:ABC_membrane	827	1112	1e-50	PFAM
AAA	1202	1384	9.94e-12	SMART
low complexity region	1435	1444	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140407

SMART Domains

Protein: ENSMUSP00000116957
Gene: ENSMUSG00000041301

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	81	350	1.2e-48	PFAM
Pfam:ABC_tran	441	568	6.3e-20	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143135

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.5%

Validation Efficiency

99% (74/75)

MGI Phenotype

FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This gene encodes the cystic fibrosis transmembrane regulator and a chloride channel that controls the regulation of other transport pathways. Mutations in this gene have been associated with autosomal recessive disorders such as cystic fibrosis and congenital bilateral aplasia of the vas deferens. Alternative splicing of exons 4, 5, and 11 have been observed, but full-length transcripts have not yet been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit high mortality associated with intestinal obstruction, and altered mucous and serous glands. Mutants, like humans with cystic fibrosis, also exhibit defective epithelial chloride transport. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030K09Rik	A	T	8: 72,451,428	Q361L	probably damaging	Het
Abca7	A	G	10: 80,002,622	T577A	probably damaging	Het
Acad12	A	T	5: 121,614,086	V54E	probably benign	Het
Ago4	A	G	4: 126,520,226	Y91H	probably damaging	Het
Akr1b10	T	C	6: 34,387,688	V28A	probably damaging	Het
Ccdc33	T	A	9: 58,101,918		probably null	Het
Ccdc7a	T	C	8: 128,935,593		probably null	Het
Ces1f	A	T	8: 93,265,794	V343E	probably damaging	Het
Csmd3	G	A	15: 47,669,729	P2375S	probably damaging	Het
Dnajb14	G	C	3: 137,908,362	A345P	probably damaging	Het
Dnajb14	C	T	3: 137,908,363	A345V	probably damaging	Het
Dnase1	G	A	16: 4,037,621	R24K	probably benign	Het
Dnmbp	C	T	19: 43,852,281	V560M	probably damaging	Het
Dopey2	T	A	16: 93,807,214	I1981N	possibly damaging	Het
Eif3a	A	C	19: 60,771,026	S770A	possibly damaging	Het
Fbxl7	A	T	15: 26,553,002	C60S	probably benign	Het
Fras1	A	T	5: 96,733,843	D2478V	possibly damaging	Het
Hrnr	A	G	3: 93,322,611	D52G	probably damaging	Het
Jmjd1c	T	A	10: 67,220,408	L823M	probably damaging	Het
Kdm1a	G	T	4: 136,568,600	C172*	probably null	Het
Kdm6b	C	T	11: 69,406,729	E295K	probably damaging	Het
Mepe	A	T	5: 104,337,074	M27L	probably benign	Het
Mogat2	A	T	7: 99,219,895	H305Q	probably damaging	Het
Mst1r	T	A	9: 107,917,266	Y1215N	probably damaging	Het
Muc5ac	A	T	7: 141,789,795	H48L	possibly damaging	Het
Myo7b	T	C	18: 31,983,695	D953G	probably damaging	Het
Ocel1	T	C	8: 71,371,828		probably benign	Het
Pcdhb6	A	G	18: 37,335,925	D633G	probably damaging	Het
Ppm1l	A	G	3: 69,497,897	I176V	probably benign	Het
Sall3	C	T	18: 80,969,861	R1120H	possibly damaging	Het
Sbf1	G	A	15: 89,300,867	P1018S	probably benign	Het
Setbp1	T	C	18: 78,857,257	Y1065C	probably damaging	Het
Slc25a2	T	C	18: 37,637,723		probably null	Het
Slc4a2	C	A	5: 24,435,890	T729K	probably damaging	Het
Sptlc2	T	C	12: 87,355,531	E207G	probably damaging	Het
Sult6b1	A	T	17: 78,906,914	F27I	probably benign	Het
Syf2	A	T	4: 134,934,578	K84N	probably damaging	Het
Tmem209	A	T	6: 30,497,167	N183K	probably benign	Het
Tmem232	G	T	17: 65,478,402	Q188K	possibly damaging	Het
Tomm70a	A	T	16: 57,152,692	T598S	probably benign	Het
Ttll13	A	G	7: 80,258,304	T556A	probably benign	Het
Vmn2r120	A	T	17: 57,524,700	L363*	probably null	Het
Xpo6	G	T	7: 126,108,619	Q872K	probably damaging	Het
Xrra1	A	C	7: 99,914,464	S553R	probably damaging	Het
Zfy1	A	T	Y: 738,765	V147E	unknown	Homo
Zfy2	T	C	Y: 2,116,267	I258V	probably benign	Homo

Other mutations in Cftr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00901:Cftr	APN	6	18268430	critical splice donor site	probably null
IGL01082:Cftr	APN	6	18226103	missense	probably damaging	0.97
IGL01113:Cftr	APN	6	18270253	missense	probably damaging	1.00
IGL01383:Cftr	APN	6	18226041	missense	probably benign	0.00
IGL01595:Cftr	APN	6	18198239	splice site	probably benign
IGL01820:Cftr	APN	6	18226139	missense	probably damaging	1.00
IGL02223:Cftr	APN	6	18221482	missense	probably damaging	1.00
IGL02249:Cftr	APN	6	18277871	missense	possibly damaging	0.58
IGL02439:Cftr	APN	6	18258238	nonsense	probably null
IGL02537:Cftr	APN	6	18274597	missense	probably benign	0.31
IGL03234:Cftr	APN	6	18225988	missense	probably damaging	0.96
BB004:Cftr	UTSW	6	18267971	missense	possibly damaging	0.81
BB014:Cftr	UTSW	6	18267971	missense	possibly damaging	0.81
PIT4453001:Cftr	UTSW	6	18214106	missense	probably damaging	0.99
PIT4520001:Cftr	UTSW	6	18277843	missense	probably benign	0.01
R0114:Cftr	UTSW	6	18282448	missense	probably damaging	1.00
R0329:Cftr	UTSW	6	18226097	missense	probably null	1.00
R0330:Cftr	UTSW	6	18226097	missense	probably null	1.00
R0331:Cftr	UTSW	6	18235226	missense	possibly damaging	0.72
R0480:Cftr	UTSW	6	18274518	splice site	probably benign
R0612:Cftr	UTSW	6	18198126	missense	probably benign	0.01
R0633:Cftr	UTSW	6	18305980	missense	probably damaging	0.99
R0830:Cftr	UTSW	6	18270225	missense	probably benign	0.02
R1559:Cftr	UTSW	6	18225937	missense	probably benign	0.01
R1629:Cftr	UTSW	6	18226106	missense	probably damaging	1.00
R1636:Cftr	UTSW	6	18226157	missense	probably damaging	0.99
R1860:Cftr	UTSW	6	18268289	missense	probably benign	0.00
R2043:Cftr	UTSW	6	18320935	missense	probably benign
R2211:Cftr	UTSW	6	18214280	missense	probably null	0.13
R4737:Cftr	UTSW	6	18299883	missense	probably benign	0.19
R4793:Cftr	UTSW	6	18226088	missense	probably damaging	1.00
R4857:Cftr	UTSW	6	18320975	missense	possibly damaging	0.92
R4984:Cftr	UTSW	6	18235199	missense	possibly damaging	0.89
R4999:Cftr	UTSW	6	18221614	missense	probably benign	0.17
R5045:Cftr	UTSW	6	18230081	missense	probably benign	0.20
R5183:Cftr	UTSW	6	18299833	missense	probably damaging	0.99
R5197:Cftr	UTSW	6	18255414	missense	probably benign	0.00
R5288:Cftr	UTSW	6	18226129	nonsense	probably null
R5337:Cftr	UTSW	6	18319059	missense	probably damaging	1.00
R5549:Cftr	UTSW	6	18227954	missense	probably benign	0.00
R5596:Cftr	UTSW	6	18268096	missense	probably benign	0.00
R5651:Cftr	UTSW	6	18255365	splice site	probably null
R5660:Cftr	UTSW	6	18313687	missense	probably benign	0.22
R5941:Cftr	UTSW	6	18313646	missense	probably damaging	1.00
R6221:Cftr	UTSW	6	18282501	missense	probably benign	0.00
R6222:Cftr	UTSW	6	18282501	missense	probably benign	0.00
R6229:Cftr	UTSW	6	18220684	missense	probably damaging	1.00
R6257:Cftr	UTSW	6	18282501	missense	probably benign	0.00
R6412:Cftr	UTSW	6	18285604	missense	probably damaging	0.97
R6459:Cftr	UTSW	6	18258236	missense	probably damaging	1.00
R6558:Cftr	UTSW	6	18222528	missense	probably damaging	1.00
R6724:Cftr	UTSW	6	18255974	nonsense	probably null
R6787:Cftr	UTSW	6	18274608	nonsense	probably null
R6861:Cftr	UTSW	6	18268108	missense	probably benign	0.00
R6888:Cftr	UTSW	6	18313730	critical splice donor site	probably null
R7084:Cftr	UTSW	6	18226138	missense	probably benign	0.17
R7105:Cftr	UTSW	6	18318972	missense	probably damaging	1.00
R7320:Cftr	UTSW	6	18319013	missense	probably damaging	0.97
R7359:Cftr	UTSW	6	18221624	missense	probably benign	0.00
R7466:Cftr	UTSW	6	18227973	missense	probably benign
R7502:Cftr	UTSW	6	18214296	missense	probably damaging	1.00
R7748:Cftr	UTSW	6	18277889	critical splice donor site	probably null
R7808:Cftr	UTSW	6	18204205	missense	probably benign
R7817:Cftr	UTSW	6	18267968	missense	probably damaging	0.97
R7927:Cftr	UTSW	6	18267971	missense	possibly damaging	0.81
R7968:Cftr	UTSW	6	18226049	missense	probably benign	0.00
R7995:Cftr	UTSW	6	18214156	missense	probably damaging	1.00
R8171:Cftr	UTSW	6	18258288	missense	probably damaging	1.00
R8210:Cftr	UTSW	6	18220697	missense	probably damaging	1.00
R8548:Cftr	UTSW	6	18273699	missense	possibly damaging	0.87
R8712:Cftr	UTSW	6	18274697	missense	probably damaging	0.99
R8737:Cftr	UTSW	6	18319729	missense	probably damaging	1.00
R8926:Cftr	UTSW	6	18268004	missense	possibly damaging	0.83
R8979:Cftr	UTSW	6	18227948	missense	probably benign	0.10
R8996:Cftr	UTSW	6	18255946	nonsense	probably null
R9087:Cftr	UTSW	6	18214181	missense	possibly damaging	0.91
R9115:Cftr	UTSW	6	18235311	missense	probably damaging	1.00
R9406:Cftr	UTSW	6	18299867	missense	probably benign	0.00
R9689:Cftr	UTSW	6	18313650	missense	probably damaging	0.99
R9700:Cftr	UTSW	6	18268360	missense	probably damaging	1.00
R9747:Cftr	UTSW	6	18285637	missense	possibly damaging	0.52

Predicted Primers

PCR Primer
(F):5'- GGGTATAGTCTCTTTTAAAGTCAGC -3'
(R):5'- TGAGCCACACAGATGGCAAG -3'

Sequencing Primer
(F):5'- AGTGATTCACTTGGCAAGTTTG -3'
(R):5'- GCGGGCAGCTCCACTTTATAC -3'

Posted On

2018-02-28