Incidental Mutation 'R6256:Tmem209'
ID506108
Institutional Source Beutler Lab
Gene Symbol Tmem209
Ensembl Gene ENSMUSG00000029782
Gene Nametransmembrane protein 209
Synonyms2700094F01Rik
MMRRC Submission 044373-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.731) question?
Stock #R6256 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location30479053-30509783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30497167 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 183 (N183K)
Ref Sequence ENSEMBL: ENSMUSP00000152560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064330] [ENSMUST00000102991] [ENSMUST00000115157] [ENSMUST00000115160] [ENSMUST00000138823] [ENSMUST00000151187] [ENSMUST00000154547] [ENSMUST00000222934]
Predicted Effect probably benign
Transcript: ENSMUST00000064330
AA Change: N341K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000067667
Gene: ENSMUSG00000029782
AA Change: N341K

DomainStartEndE-ValueType
Pfam:CytochromB561_N 5 343 4.1e-88 PFAM
Pfam:CytochromB561_N 341 438 2.2e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102991
AA Change: N341K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000100056
Gene: ENSMUSG00000029782
AA Change: N341K

DomainStartEndE-ValueType
Pfam:CytochromB561_N 5 376 5.2e-107 PFAM
Pfam:CytochromB561_N 372 519 3.1e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115157
AA Change: N340K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110810
Gene: ENSMUSG00000029782
AA Change: N340K

DomainStartEndE-ValueType
Pfam:CytochromB561_N 4 560 4.8e-209 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115160
AA Change: N341K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110813
Gene: ENSMUSG00000029782
AA Change: N341K

DomainStartEndE-ValueType
Pfam:CytochromB561_N 6 560 6.4e-159 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138823
AA Change: N341K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138292
Gene: ENSMUSG00000029782
AA Change: N341K

DomainStartEndE-ValueType
Pfam:CytochromB561_N 5 560 1.2e-205 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151187
AA Change: N183K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138232
Gene: ENSMUSG00000029782
AA Change: N183K

DomainStartEndE-ValueType
Pfam:CytochromB561_N 1 403 1.5e-160 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154547
SMART Domains Protein: ENSMUSP00000145248
Gene: ENSMUSG00000029782

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202269
Predicted Effect probably benign
Transcript: ENSMUST00000222934
AA Change: N183K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0592 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A T 8: 72,451,428 Q361L probably damaging Het
Abca7 A G 10: 80,002,622 T577A probably damaging Het
Acad12 A T 5: 121,614,086 V54E probably benign Het
Ago4 A G 4: 126,520,226 Y91H probably damaging Het
Akr1b10 T C 6: 34,387,688 V28A probably damaging Het
Ccdc33 T A 9: 58,101,918 probably null Het
Ccdc7a T C 8: 128,935,593 probably null Het
Ces1f A T 8: 93,265,794 V343E probably damaging Het
Cftr T C 6: 18,274,661 L896P probably damaging Het
Csmd3 G A 15: 47,669,729 P2375S probably damaging Het
Dnajb14 G C 3: 137,908,362 A345P probably damaging Het
Dnajb14 C T 3: 137,908,363 A345V probably damaging Het
Dnase1 G A 16: 4,037,621 R24K probably benign Het
Dnmbp C T 19: 43,852,281 V560M probably damaging Het
Dopey2 T A 16: 93,807,214 I1981N possibly damaging Het
Eif3a A C 19: 60,771,026 S770A possibly damaging Het
Fbxl7 A T 15: 26,553,002 C60S probably benign Het
Fras1 A T 5: 96,733,843 D2478V possibly damaging Het
Hrnr A G 3: 93,322,611 D52G probably damaging Het
Jmjd1c T A 10: 67,220,408 L823M probably damaging Het
Kdm1a G T 4: 136,568,600 C172* probably null Het
Kdm6b C T 11: 69,406,729 E295K probably damaging Het
Mepe A T 5: 104,337,074 M27L probably benign Het
Mogat2 A T 7: 99,219,895 H305Q probably damaging Het
Mst1r T A 9: 107,917,266 Y1215N probably damaging Het
Muc5ac A T 7: 141,789,795 H48L possibly damaging Het
Myo7b T C 18: 31,983,695 D953G probably damaging Het
Ocel1 T C 8: 71,371,828 probably benign Het
Pcdhb6 A G 18: 37,335,925 D633G probably damaging Het
Ppm1l A G 3: 69,497,897 I176V probably benign Het
Sall3 C T 18: 80,969,861 R1120H possibly damaging Het
Sbf1 G A 15: 89,300,867 P1018S probably benign Het
Setbp1 T C 18: 78,857,257 Y1065C probably damaging Het
Slc25a2 T C 18: 37,637,723 probably null Het
Slc4a2 C A 5: 24,435,890 T729K probably damaging Het
Sptlc2 T C 12: 87,355,531 E207G probably damaging Het
Sult6b1 A T 17: 78,906,914 F27I probably benign Het
Syf2 A T 4: 134,934,578 K84N probably damaging Het
Tmem232 G T 17: 65,478,402 Q188K possibly damaging Het
Tomm70a A T 16: 57,152,692 T598S probably benign Het
Ttll13 A G 7: 80,258,304 T556A probably benign Het
Vmn2r120 A T 17: 57,524,700 L363* probably null Het
Xpo6 G T 7: 126,108,619 Q872K probably damaging Het
Xrra1 A C 7: 99,914,464 S553R probably damaging Het
Zfy1 A T Y: 738,765 V147E unknown Homo
Zfy2 T C Y: 2,116,267 I258V probably benign Homo
Other mutations in Tmem209
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Tmem209 APN 6 30487417 missense probably damaging 0.99
IGL01068:Tmem209 APN 6 30502086 missense probably benign 0.18
IGL02106:Tmem209 APN 6 30508660 splice site probably null
IGL02109:Tmem209 APN 6 30497945 missense probably damaging 1.00
IGL02250:Tmem209 APN 6 30487388 missense probably damaging 1.00
R0012:Tmem209 UTSW 6 30502113 splice site probably benign
R0426:Tmem209 UTSW 6 30491182 missense probably damaging 0.99
R0452:Tmem209 UTSW 6 30487381 missense probably damaging 1.00
R0557:Tmem209 UTSW 6 30501914 missense probably damaging 0.99
R0690:Tmem209 UTSW 6 30505834 missense probably null 1.00
R1202:Tmem209 UTSW 6 30508790 missense probably benign 0.01
R1697:Tmem209 UTSW 6 30497868 missense probably benign 0.00
R3821:Tmem209 UTSW 6 30505960 missense probably damaging 1.00
R4795:Tmem209 UTSW 6 30501955 missense probably benign 0.00
R5131:Tmem209 UTSW 6 30497167 missense probably benign 0.00
R5715:Tmem209 UTSW 6 30497923 nonsense probably null
R6030:Tmem209 UTSW 6 30482968 missense probably damaging 1.00
R6030:Tmem209 UTSW 6 30482968 missense probably damaging 1.00
R6153:Tmem209 UTSW 6 30505795 missense probably benign 0.01
R6181:Tmem209 UTSW 6 30505971 missense probably damaging 1.00
R6721:Tmem209 UTSW 6 30497175 missense probably benign 0.00
R6873:Tmem209 UTSW 6 30508456 missense probably damaging 1.00
R7062:Tmem209 UTSW 6 30502017 missense probably damaging 1.00
R7341:Tmem209 UTSW 6 30494795 missense probably benign 0.00
R7461:Tmem209 UTSW 6 30508470 nonsense probably null
R7790:Tmem209 UTSW 6 30497855 missense probably damaging 1.00
R8354:Tmem209 UTSW 6 30489309 missense probably damaging 0.97
R8454:Tmem209 UTSW 6 30489309 missense probably damaging 0.97
R8527:Tmem209 UTSW 6 30497238 missense probably damaging 1.00
R8542:Tmem209 UTSW 6 30497238 missense probably damaging 1.00
RF020:Tmem209 UTSW 6 30487418 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGTTCAATGACTGGCACGAAAC -3'
(R):5'- ACCATGTACTAGACCGTTACATTC -3'

Sequencing Primer
(F):5'- GGCACGAAACACAACTTAACATTTTG -3'
(R):5'- TGTACTTAAGAGCAAAACACATACAC -3'
Posted On2018-02-28