Incidental Mutation 'R6256:Ttll13'
ID506114
Institutional Source Beutler Lab
Gene Symbol Ttll13
Ensembl Gene ENSMUSG00000045467
Gene Nametubulin tyrosine ligase-like family, member 13
Synonyms1700111A04Rik
MMRRC Submission 044373-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R6256 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location80246376-80260821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80258304 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 556 (T556A)
Ref Sequence ENSEMBL: ENSMUSP00000062795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058266] [ENSMUST00000117989] [ENSMUST00000205270]
Predicted Effect probably benign
Transcript: ENSMUST00000058266
AA Change: T556A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000062795
Gene: ENSMUSG00000045467
AA Change: T556A

DomainStartEndE-ValueType
low complexity region 9 30 N/A INTRINSIC
low complexity region 78 86 N/A INTRINSIC
Pfam:TTL 131 427 3.4e-90 PFAM
coiled coil region 504 528 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
low complexity region 646 657 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107381
SMART Domains Protein: ENSMUSP00000103004
Gene: ENSMUSG00000045467

DomainStartEndE-ValueType
low complexity region 9 30 N/A INTRINSIC
low complexity region 78 86 N/A INTRINSIC
Pfam:TTL 131 427 3.5e-90 PFAM
coiled coil region 504 528 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117989
SMART Domains Protein: ENSMUSP00000113444
Gene: ENSMUSG00000047084

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
coiled coil region 46 70 N/A INTRINSIC
Pfam:Neugrin 73 293 1.2e-99 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138005
Predicted Effect probably benign
Transcript: ENSMUST00000205270
AA Change: T525A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A T 8: 72,451,428 Q361L probably damaging Het
Abca7 A G 10: 80,002,622 T577A probably damaging Het
Acad12 A T 5: 121,614,086 V54E probably benign Het
Ago4 A G 4: 126,520,226 Y91H probably damaging Het
Akr1b10 T C 6: 34,387,688 V28A probably damaging Het
Ccdc33 T A 9: 58,101,918 probably null Het
Ccdc7a T C 8: 128,935,593 probably null Het
Ces1f A T 8: 93,265,794 V343E probably damaging Het
Cftr T C 6: 18,274,661 L896P probably damaging Het
Csmd3 G A 15: 47,669,729 P2375S probably damaging Het
Dnajb14 G C 3: 137,908,362 A345P probably damaging Het
Dnajb14 C T 3: 137,908,363 A345V probably damaging Het
Dnase1 G A 16: 4,037,621 R24K probably benign Het
Dnmbp C T 19: 43,852,281 V560M probably damaging Het
Dopey2 T A 16: 93,807,214 I1981N possibly damaging Het
Eif3a A C 19: 60,771,026 S770A possibly damaging Het
Fbxl7 A T 15: 26,553,002 C60S probably benign Het
Fras1 A T 5: 96,733,843 D2478V possibly damaging Het
Hrnr A G 3: 93,322,611 D52G probably damaging Het
Jmjd1c T A 10: 67,220,408 L823M probably damaging Het
Kdm1a G T 4: 136,568,600 C172* probably null Het
Kdm6b C T 11: 69,406,729 E295K probably damaging Het
Mepe A T 5: 104,337,074 M27L probably benign Het
Mogat2 A T 7: 99,219,895 H305Q probably damaging Het
Mst1r T A 9: 107,917,266 Y1215N probably damaging Het
Muc5ac A T 7: 141,789,795 H48L possibly damaging Het
Myo7b T C 18: 31,983,695 D953G probably damaging Het
Ocel1 T C 8: 71,371,828 probably benign Het
Pcdhb6 A G 18: 37,335,925 D633G probably damaging Het
Ppm1l A G 3: 69,497,897 I176V probably benign Het
Sall3 C T 18: 80,969,861 R1120H possibly damaging Het
Sbf1 G A 15: 89,300,867 P1018S probably benign Het
Setbp1 T C 18: 78,857,257 Y1065C probably damaging Het
Slc25a2 T C 18: 37,637,723 probably null Het
Slc4a2 C A 5: 24,435,890 T729K probably damaging Het
Sptlc2 T C 12: 87,355,531 E207G probably damaging Het
Sult6b1 A T 17: 78,906,914 F27I probably benign Het
Syf2 A T 4: 134,934,578 K84N probably damaging Het
Tmem209 A T 6: 30,497,167 N183K probably benign Het
Tmem232 G T 17: 65,478,402 Q188K possibly damaging Het
Tomm70a A T 16: 57,152,692 T598S probably benign Het
Vmn2r120 A T 17: 57,524,700 L363* probably null Het
Xpo6 G T 7: 126,108,619 Q872K probably damaging Het
Xrra1 A C 7: 99,914,464 S553R probably damaging Het
Zfy1 A T Y: 738,765 V147E unknown Homo
Zfy2 T C Y: 2,116,267 I258V probably benign Homo
Other mutations in Ttll13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00808:Ttll13 APN 7 80259549 missense possibly damaging 0.73
IGL01289:Ttll13 APN 7 80260439 missense probably benign
IGL02026:Ttll13 APN 7 80260379 missense probably benign 0.03
IGL02816:Ttll13 APN 7 80253094 missense possibly damaging 0.91
R0345:Ttll13 UTSW 7 80247336 missense probably benign 0.00
R0347:Ttll13 UTSW 7 80260505 missense possibly damaging 0.73
R0491:Ttll13 UTSW 7 80260350 missense probably benign
R1779:Ttll13 UTSW 7 80260508 missense probably benign 0.33
R1983:Ttll13 UTSW 7 80253616 missense possibly damaging 0.70
R2218:Ttll13 UTSW 7 80252502 missense probably damaging 1.00
R2520:Ttll13 UTSW 7 80250216 missense probably damaging 1.00
R4496:Ttll13 UTSW 7 80256919 missense probably benign 0.08
R4736:Ttll13 UTSW 7 80248276 splice site probably null
R5330:Ttll13 UTSW 7 80260509 missense probably benign 0.33
R5930:Ttll13 UTSW 7 80253166 missense probably damaging 1.00
R5985:Ttll13 UTSW 7 80254638 missense probably damaging 1.00
R6060:Ttll13 UTSW 7 80258743 missense probably damaging 1.00
R6182:Ttll13 UTSW 7 80260233 missense probably benign 0.18
R6501:Ttll13 UTSW 7 80250176 missense possibly damaging 0.89
R6901:Ttll13 UTSW 7 80250182 missense probably damaging 1.00
R7064:Ttll13 UTSW 7 80257030 missense probably null 0.53
R7127:Ttll13 UTSW 7 80253658 missense possibly damaging 0.53
R7217:Ttll13 UTSW 7 80254163 missense probably damaging 1.00
R7241:Ttll13 UTSW 7 80254163 missense probably damaging 1.00
R7243:Ttll13 UTSW 7 80254163 missense probably damaging 1.00
R7244:Ttll13 UTSW 7 80254163 missense probably damaging 1.00
R7246:Ttll13 UTSW 7 80254163 missense probably damaging 1.00
R7317:Ttll13 UTSW 7 80254163 missense probably damaging 1.00
R7340:Ttll13 UTSW 7 80257024 missense probably damaging 0.98
R7453:Ttll13 UTSW 7 80260434 missense probably benign
R7579:Ttll13 UTSW 7 80258233 missense probably benign 0.00
R7810:Ttll13 UTSW 7 80253127 missense probably damaging 1.00
R7855:Ttll13 UTSW 7 80254097 missense probably damaging 1.00
R7860:Ttll13 UTSW 7 80255387 missense probably benign 0.02
R8122:Ttll13 UTSW 7 80259469 missense probably benign 0.16
R8739:Ttll13 UTSW 7 80253175 missense probably damaging 0.98
Z1189:Ttll13 UTSW 7 80258743 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATTCCAGCAACACCAGGTG -3'
(R):5'- CTTCTGTTCCAAAAGGTCAGATCC -3'

Sequencing Primer
(F):5'- ACACCAGGTGTTCCTTTCATTAG -3'
(R):5'- GTTCCAAAAGGTCAGATCCAATTTAC -3'
Posted On2018-02-28