Incidental Mutation 'R6256:Xpo6'
ID506116
Institutional Source Beutler Lab
Gene Symbol Xpo6
Ensembl Gene ENSMUSG00000000131
Gene Nameexportin 6
Synonyms2610005L19Rik, C230091E20Rik, Ranbp20
MMRRC Submission 044373-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.854) question?
Stock #R6256 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location126101715-126200501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 126108619 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 872 (Q872K)
Ref Sequence ENSEMBL: ENSMUSP00000009344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009344] [ENSMUST00000165608] [ENSMUST00000166538] [ENSMUST00000166719] [ENSMUST00000168189] [ENSMUST00000171861]
Predicted Effect probably damaging
Transcript: ENSMUST00000009344
AA Change: Q872K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000009344
Gene: ENSMUSG00000000131
AA Change: Q872K

DomainStartEndE-ValueType
IBN_N 31 97 4.04e-6 SMART
Pfam:Xpo1 103 290 1.4e-29 PFAM
low complexity region 469 484 N/A INTRINSIC
low complexity region 672 684 N/A INTRINSIC
low complexity region 1022 1034 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165608
Predicted Effect unknown
Transcript: ENSMUST00000165660
AA Change: Q102K
Predicted Effect probably benign
Transcript: ENSMUST00000166538
Predicted Effect probably benign
Transcript: ENSMUST00000166719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167315
Predicted Effect probably damaging
Transcript: ENSMUST00000168189
AA Change: Q873K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130527
Gene: ENSMUSG00000000131
AA Change: Q873K

DomainStartEndE-ValueType
IBN_N 31 97 4.04e-6 SMART
Pfam:Xpo1 103 290 1.1e-25 PFAM
low complexity region 469 485 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
low complexity region 1023 1035 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168564
SMART Domains Protein: ENSMUSP00000129881
Gene: ENSMUSG00000000131

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168933
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170675
Predicted Effect probably benign
Transcript: ENSMUST00000171861
Meta Mutation Damage Score 0.2079 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the importin-beta family. Members of this family are regulated by the GTPase Ran to mediate transport of cargo across the nuclear envelope. This protein has been shown to mediate nuclear export of profilin-actin complexes. A pseudogene of this gene is located on the long arm of chromosome 14. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A T 8: 72,451,428 Q361L probably damaging Het
Abca7 A G 10: 80,002,622 T577A probably damaging Het
Acad12 A T 5: 121,614,086 V54E probably benign Het
Ago4 A G 4: 126,520,226 Y91H probably damaging Het
Akr1b10 T C 6: 34,387,688 V28A probably damaging Het
Ccdc33 T A 9: 58,101,918 probably null Het
Ccdc7a T C 8: 128,935,593 probably null Het
Ces1f A T 8: 93,265,794 V343E probably damaging Het
Cftr T C 6: 18,274,661 L896P probably damaging Het
Csmd3 G A 15: 47,669,729 P2375S probably damaging Het
Dnajb14 G C 3: 137,908,362 A345P probably damaging Het
Dnajb14 C T 3: 137,908,363 A345V probably damaging Het
Dnase1 G A 16: 4,037,621 R24K probably benign Het
Dnmbp C T 19: 43,852,281 V560M probably damaging Het
Dopey2 T A 16: 93,807,214 I1981N possibly damaging Het
Eif3a A C 19: 60,771,026 S770A possibly damaging Het
Fbxl7 A T 15: 26,553,002 C60S probably benign Het
Fras1 A T 5: 96,733,843 D2478V possibly damaging Het
Hrnr A G 3: 93,322,611 D52G probably damaging Het
Jmjd1c T A 10: 67,220,408 L823M probably damaging Het
Kdm1a G T 4: 136,568,600 C172* probably null Het
Kdm6b C T 11: 69,406,729 E295K probably damaging Het
Mepe A T 5: 104,337,074 M27L probably benign Het
Mogat2 A T 7: 99,219,895 H305Q probably damaging Het
Mst1r T A 9: 107,917,266 Y1215N probably damaging Het
Muc5ac A T 7: 141,789,795 H48L possibly damaging Het
Myo7b T C 18: 31,983,695 D953G probably damaging Het
Ocel1 T C 8: 71,371,828 probably benign Het
Pcdhb6 A G 18: 37,335,925 D633G probably damaging Het
Ppm1l A G 3: 69,497,897 I176V probably benign Het
Sall3 C T 18: 80,969,861 R1120H possibly damaging Het
Sbf1 G A 15: 89,300,867 P1018S probably benign Het
Setbp1 T C 18: 78,857,257 Y1065C probably damaging Het
Slc25a2 T C 18: 37,637,723 probably null Het
Slc4a2 C A 5: 24,435,890 T729K probably damaging Het
Sptlc2 T C 12: 87,355,531 E207G probably damaging Het
Sult6b1 A T 17: 78,906,914 F27I probably benign Het
Syf2 A T 4: 134,934,578 K84N probably damaging Het
Tmem209 A T 6: 30,497,167 N183K probably benign Het
Tmem232 G T 17: 65,478,402 Q188K possibly damaging Het
Tomm70a A T 16: 57,152,692 T598S probably benign Het
Ttll13 A G 7: 80,258,304 T556A probably benign Het
Vmn2r120 A T 17: 57,524,700 L363* probably null Het
Xrra1 A C 7: 99,914,464 S553R probably damaging Het
Zfy1 A T Y: 738,765 V147E unknown Homo
Zfy2 T C Y: 2,116,267 I258V probably benign Homo
Other mutations in Xpo6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Xpo6 APN 7 126129568 missense probably benign 0.03
IGL01432:Xpo6 APN 7 126124381 missense probably benign 0.31
IGL01627:Xpo6 APN 7 126149334 missense probably damaging 1.00
IGL01878:Xpo6 APN 7 126174193 missense probably benign 0.35
IGL02185:Xpo6 APN 7 126113808 splice site probably benign
IGL02744:Xpo6 APN 7 126108448 unclassified probably benign
IGL02927:Xpo6 APN 7 126156729 missense possibly damaging 0.86
IGL03216:Xpo6 APN 7 126104813 missense probably damaging 1.00
Cerise UTSW 7 126108844 missense probably damaging 1.00
Crayola UTSW 7 126107078 missense probably damaging 0.98
pastel UTSW 7 126108619 missense probably damaging 1.00
R0845:Xpo6 UTSW 7 126129543 splice site probably benign
R1671:Xpo6 UTSW 7 126108543 missense possibly damaging 0.92
R2349:Xpo6 UTSW 7 126113703 missense probably benign 0.18
R3051:Xpo6 UTSW 7 126104721 missense probably damaging 1.00
R3052:Xpo6 UTSW 7 126104721 missense probably damaging 1.00
R3053:Xpo6 UTSW 7 126104721 missense probably damaging 1.00
R3902:Xpo6 UTSW 7 126120409 missense probably damaging 1.00
R4011:Xpo6 UTSW 7 126140608 missense probably benign 0.13
R4231:Xpo6 UTSW 7 126174182 missense possibly damaging 0.66
R4569:Xpo6 UTSW 7 126128255 missense probably damaging 1.00
R4604:Xpo6 UTSW 7 126113752 missense possibly damaging 0.52
R4736:Xpo6 UTSW 7 126140583 missense probably benign
R4919:Xpo6 UTSW 7 126152943 missense probably benign 0.01
R4953:Xpo6 UTSW 7 126169271 missense probably damaging 1.00
R5017:Xpo6 UTSW 7 126104747 missense probably benign 0.31
R5590:Xpo6 UTSW 7 126107078 missense probably damaging 0.98
R5856:Xpo6 UTSW 7 126149502 intron probably benign
R6077:Xpo6 UTSW 7 126109952 missense possibly damaging 0.67
R6156:Xpo6 UTSW 7 126108844 missense probably damaging 1.00
R6481:Xpo6 UTSW 7 126112885 missense probably damaging 1.00
R6500:Xpo6 UTSW 7 126171090 intron probably benign
R7407:Xpo6 UTSW 7 126171052 missense probably damaging 0.99
R7480:Xpo6 UTSW 7 126102333 nonsense probably null
R7630:Xpo6 UTSW 7 126140389 splice site probably null
R7794:Xpo6 UTSW 7 126160863 missense probably damaging 0.98
R7984:Xpo6 UTSW 7 126120444 missense probably benign
R8022:Xpo6 UTSW 7 126169254 missense probably benign 0.04
R8283:Xpo6 UTSW 7 126128249 missense possibly damaging 0.90
R8438:Xpo6 UTSW 7 126160882 missense possibly damaging 0.71
X0012:Xpo6 UTSW 7 126169227 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TACGTACCTCAGCAATGATGG -3'
(R):5'- TTCGAGTACAGATGGGCGTG -3'

Sequencing Primer
(F):5'- CAATGATGGGGTACACTTGCTCC -3'
(R):5'- TGCCGTTCACAGAGCAGATC -3'
Posted On2018-02-28