Incidental Mutation 'R6256:Ocel1'
ID506118
Institutional Source Beutler Lab
Gene Symbol Ocel1
Ensembl Gene ENSMUSG00000002396
Gene Nameoccludin/ELL domain containing 1
Synonyms
MMRRC Submission 044373-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6256 (G1)
Quality Score85.0076
Status Validated
Chromosome8
Chromosomal Location71371298-71379361 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 71371828 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002466] [ENSMUST00000002469] [ENSMUST00000019169] [ENSMUST00000110051] [ENSMUST00000110052] [ENSMUST00000110053] [ENSMUST00000110054] [ENSMUST00000137058] [ENSMUST00000139541]
Predicted Effect probably benign
Transcript: ENSMUST00000002466
SMART Domains Protein: ENSMUSP00000002466
Gene: ENSMUSG00000002393

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
ZnF_C4 54 125 1.48e-38 SMART
low complexity region 173 185 N/A INTRINSIC
HOLI 191 351 1.07e-39 SMART
Predicted Effect unknown
Transcript: ENSMUST00000002469
AA Change: S52P
SMART Domains Protein: ENSMUSP00000002469
Gene: ENSMUSG00000002396
AA Change: S52P

DomainStartEndE-ValueType
low complexity region 5 23 N/A INTRINSIC
low complexity region 29 62 N/A INTRINSIC
Pfam:Occludin_ELL 106 207 8.7e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000019169
SMART Domains Protein: ENSMUSP00000019169
Gene: ENSMUSG00000002395

DomainStartEndE-ValueType
Pfam:Use1 15 266 9.7e-110 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000110051
AA Change: S52P
SMART Domains Protein: ENSMUSP00000105678
Gene: ENSMUSG00000002396
AA Change: S52P

DomainStartEndE-ValueType
low complexity region 5 23 N/A INTRINSIC
low complexity region 29 62 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000110052
AA Change: S52P
SMART Domains Protein: ENSMUSP00000105679
Gene: ENSMUSG00000002396
AA Change: S52P

DomainStartEndE-ValueType
low complexity region 5 23 N/A INTRINSIC
low complexity region 29 62 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110053
SMART Domains Protein: ENSMUSP00000105680
Gene: ENSMUSG00000002395

DomainStartEndE-ValueType
Pfam:Use1 30 280 4.6e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110054
SMART Domains Protein: ENSMUSP00000105681
Gene: ENSMUSG00000002395

DomainStartEndE-ValueType
Pfam:Use1 15 266 9.7e-110 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124732
SMART Domains Protein: ENSMUSP00000116498
Gene: ENSMUSG00000002393

DomainStartEndE-ValueType
ZnF_C4 38 80 4.35e-4 SMART
low complexity region 128 140 N/A INTRINSIC
HOLI 146 254 2.72e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140236
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154550
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137137
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156270
Predicted Effect probably benign
Transcript: ENSMUST00000137058
SMART Domains Protein: ENSMUSP00000121648
Gene: ENSMUSG00000002393

DomainStartEndE-ValueType
low complexity region 39 62 N/A INTRINSIC
ZnF_C4 76 118 4.35e-4 SMART
Pfam:Hormone_recep 175 270 9.4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137734
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142685
Predicted Effect probably benign
Transcript: ENSMUST00000139541
SMART Domains Protein: ENSMUSP00000122406
Gene: ENSMUSG00000002395

DomainStartEndE-ValueType
Pfam:Use1 15 74 2e-25 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A T 8: 72,451,428 Q361L probably damaging Het
Abca7 A G 10: 80,002,622 T577A probably damaging Het
Acad12 A T 5: 121,614,086 V54E probably benign Het
Ago4 A G 4: 126,520,226 Y91H probably damaging Het
Akr1b10 T C 6: 34,387,688 V28A probably damaging Het
Ccdc33 T A 9: 58,101,918 probably null Het
Ccdc7a T C 8: 128,935,593 probably null Het
Ces1f A T 8: 93,265,794 V343E probably damaging Het
Cftr T C 6: 18,274,661 L896P probably damaging Het
Csmd3 G A 15: 47,669,729 P2375S probably damaging Het
Dnajb14 G C 3: 137,908,362 A345P probably damaging Het
Dnajb14 C T 3: 137,908,363 A345V probably damaging Het
Dnase1 G A 16: 4,037,621 R24K probably benign Het
Dnmbp C T 19: 43,852,281 V560M probably damaging Het
Dopey2 T A 16: 93,807,214 I1981N possibly damaging Het
Eif3a A C 19: 60,771,026 S770A possibly damaging Het
Fbxl7 A T 15: 26,553,002 C60S probably benign Het
Fras1 A T 5: 96,733,843 D2478V possibly damaging Het
Hrnr A G 3: 93,322,611 D52G probably damaging Het
Jmjd1c T A 10: 67,220,408 L823M probably damaging Het
Kdm1a G T 4: 136,568,600 C172* probably null Het
Kdm6b C T 11: 69,406,729 E295K probably damaging Het
Mepe A T 5: 104,337,074 M27L probably benign Het
Mogat2 A T 7: 99,219,895 H305Q probably damaging Het
Mst1r T A 9: 107,917,266 Y1215N probably damaging Het
Muc5ac A T 7: 141,789,795 H48L possibly damaging Het
Myo7b T C 18: 31,983,695 D953G probably damaging Het
Pcdhb6 A G 18: 37,335,925 D633G probably damaging Het
Ppm1l A G 3: 69,497,897 I176V probably benign Het
Sall3 C T 18: 80,969,861 R1120H possibly damaging Het
Sbf1 G A 15: 89,300,867 P1018S probably benign Het
Setbp1 T C 18: 78,857,257 Y1065C probably damaging Het
Slc25a2 T C 18: 37,637,723 probably null Het
Slc4a2 C A 5: 24,435,890 T729K probably damaging Het
Sptlc2 T C 12: 87,355,531 E207G probably damaging Het
Sult6b1 A T 17: 78,906,914 F27I probably benign Het
Syf2 A T 4: 134,934,578 K84N probably damaging Het
Tmem209 A T 6: 30,497,167 N183K probably benign Het
Tmem232 G T 17: 65,478,402 Q188K possibly damaging Het
Tomm70a A T 16: 57,152,692 T598S probably benign Het
Ttll13 A G 7: 80,258,304 T556A probably benign Het
Vmn2r120 A T 17: 57,524,700 L363* probably null Het
Xpo6 G T 7: 126,108,619 Q872K probably damaging Het
Xrra1 A C 7: 99,914,464 S553R probably damaging Het
Zfy1 A T Y: 738,765 V147E unknown Homo
Zfy2 T C Y: 2,116,267 I258V probably benign Homo
Other mutations in Ocel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1084:Ocel1 UTSW 8 71371988 splice site probably null
R4744:Ocel1 UTSW 8 71372753 missense probably damaging 1.00
R5560:Ocel1 UTSW 8 71372478 missense probably damaging 0.99
R7653:Ocel1 UTSW 8 71371916 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCGGTTTCAAGAATGGGGC -3'
(R):5'- TCTTACAACGAGTGGGCAC -3'

Sequencing Primer
(F):5'- AGCCACTCTCGAGCATGACG -3'
(R):5'- CTCACAGCTCGTAGTCAGGTAC -3'
Posted On2018-02-28