Incidental Mutation 'R6256:Ces1f'
ID506120
Institutional Source Beutler Lab
Gene Symbol Ces1f
Ensembl Gene ENSMUSG00000031725
Gene Namecarboxylesterase 1F
SynonymsTGH-2, CesML1
MMRRC Submission 044373-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R6256 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location93256236-93279747 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93265794 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 343 (V343E)
Ref Sequence ENSEMBL: ENSMUSP00000034178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034178]
Predicted Effect probably damaging
Transcript: ENSMUST00000034178
AA Change: V343E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034178
Gene: ENSMUSG00000031725
AA Change: V343E

DomainStartEndE-ValueType
Pfam:COesterase 1 545 2.5e-166 PFAM
Pfam:Abhydrolase_3 136 244 4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124066
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151261
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A T 8: 72,451,428 Q361L probably damaging Het
Abca7 A G 10: 80,002,622 T577A probably damaging Het
Acad12 A T 5: 121,614,086 V54E probably benign Het
Ago4 A G 4: 126,520,226 Y91H probably damaging Het
Akr1b10 T C 6: 34,387,688 V28A probably damaging Het
Ccdc33 T A 9: 58,101,918 probably null Het
Ccdc7a T C 8: 128,935,593 probably null Het
Cftr T C 6: 18,274,661 L896P probably damaging Het
Csmd3 G A 15: 47,669,729 P2375S probably damaging Het
Dnajb14 G C 3: 137,908,362 A345P probably damaging Het
Dnajb14 C T 3: 137,908,363 A345V probably damaging Het
Dnase1 G A 16: 4,037,621 R24K probably benign Het
Dnmbp C T 19: 43,852,281 V560M probably damaging Het
Dopey2 T A 16: 93,807,214 I1981N possibly damaging Het
Eif3a A C 19: 60,771,026 S770A possibly damaging Het
Fbxl7 A T 15: 26,553,002 C60S probably benign Het
Fras1 A T 5: 96,733,843 D2478V possibly damaging Het
Hrnr A G 3: 93,322,611 D52G probably damaging Het
Jmjd1c T A 10: 67,220,408 L823M probably damaging Het
Kdm1a G T 4: 136,568,600 C172* probably null Het
Kdm6b C T 11: 69,406,729 E295K probably damaging Het
Mepe A T 5: 104,337,074 M27L probably benign Het
Mogat2 A T 7: 99,219,895 H305Q probably damaging Het
Mst1r T A 9: 107,917,266 Y1215N probably damaging Het
Muc5ac A T 7: 141,789,795 H48L possibly damaging Het
Myo7b T C 18: 31,983,695 D953G probably damaging Het
Ocel1 T C 8: 71,371,828 probably benign Het
Pcdhb6 A G 18: 37,335,925 D633G probably damaging Het
Ppm1l A G 3: 69,497,897 I176V probably benign Het
Sall3 C T 18: 80,969,861 R1120H possibly damaging Het
Sbf1 G A 15: 89,300,867 P1018S probably benign Het
Setbp1 T C 18: 78,857,257 Y1065C probably damaging Het
Slc25a2 T C 18: 37,637,723 probably null Het
Slc4a2 C A 5: 24,435,890 T729K probably damaging Het
Sptlc2 T C 12: 87,355,531 E207G probably damaging Het
Sult6b1 A T 17: 78,906,914 F27I probably benign Het
Syf2 A T 4: 134,934,578 K84N probably damaging Het
Tmem209 A T 6: 30,497,167 N183K probably benign Het
Tmem232 G T 17: 65,478,402 Q188K possibly damaging Het
Tomm70a A T 16: 57,152,692 T598S probably benign Het
Ttll13 A G 7: 80,258,304 T556A probably benign Het
Vmn2r120 A T 17: 57,524,700 L363* probably null Het
Xpo6 G T 7: 126,108,619 Q872K probably damaging Het
Xrra1 A C 7: 99,914,464 S553R probably damaging Het
Zfy1 A T Y: 738,765 V147E unknown Homo
Zfy2 T C Y: 2,116,267 I258V probably benign Homo
Other mutations in Ces1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Ces1f APN 8 93267992 missense probably benign
IGL01143:Ces1f APN 8 93271830 critical splice donor site probably null
IGL01571:Ces1f APN 8 93258368 missense probably benign 0.00
IGL01731:Ces1f APN 8 93267320 missense possibly damaging 0.73
IGL01733:Ces1f APN 8 93270014 missense probably damaging 1.00
IGL02124:Ces1f APN 8 93265860 missense possibly damaging 0.54
IGL03058:Ces1f APN 8 93269972 critical splice donor site probably null
IGL03124:Ces1f APN 8 93275384 missense probably benign
3-1:Ces1f UTSW 8 93275431 missense probably benign 0.29
G5030:Ces1f UTSW 8 93274219 missense probably benign 0.03
R0025:Ces1f UTSW 8 93271885 missense probably benign 0.27
R0025:Ces1f UTSW 8 93271885 missense probably benign 0.27
R0113:Ces1f UTSW 8 93279699 start codon destroyed probably null 0.93
R0201:Ces1f UTSW 8 93267329 missense probably null 0.01
R0306:Ces1f UTSW 8 93276544 splice site probably benign
R0317:Ces1f UTSW 8 93263391 missense probably benign 0.05
R0558:Ces1f UTSW 8 93275389 missense probably benign
R0791:Ces1f UTSW 8 93271889 missense possibly damaging 0.52
R0833:Ces1f UTSW 8 93270024 missense probably damaging 0.98
R0836:Ces1f UTSW 8 93270024 missense probably damaging 0.98
R1087:Ces1f UTSW 8 93258295 missense probably damaging 1.00
R1118:Ces1f UTSW 8 93267242 splice site probably benign
R1147:Ces1f UTSW 8 93258281 missense possibly damaging 0.89
R1147:Ces1f UTSW 8 93258281 missense possibly damaging 0.89
R1183:Ces1f UTSW 8 93268005 missense probably benign 0.01
R1371:Ces1f UTSW 8 93279649 missense probably damaging 0.98
R1480:Ces1f UTSW 8 93274154 missense probably benign 0.07
R1522:Ces1f UTSW 8 93271889 missense possibly damaging 0.52
R1681:Ces1f UTSW 8 93275414 missense probably benign 0.00
R1865:Ces1f UTSW 8 93274265 splice site probably benign
R2437:Ces1f UTSW 8 93270139 splice site probably null
R3038:Ces1f UTSW 8 93256598 missense probably damaging 1.00
R4199:Ces1f UTSW 8 93256889 missense probably benign 0.00
R4406:Ces1f UTSW 8 93263322 missense probably benign
R5385:Ces1f UTSW 8 93265760 nonsense probably null
R5450:Ces1f UTSW 8 93265795 missense probably benign 0.04
R5627:Ces1f UTSW 8 93279699 start codon destroyed probably null 0.93
R6182:Ces1f UTSW 8 93256496 missense probably benign 0.43
R6379:Ces1f UTSW 8 93279651 missense probably benign
R6443:Ces1f UTSW 8 93275365 missense probably benign 0.00
R6967:Ces1f UTSW 8 93267997 missense probably benign 0.00
R7158:Ces1f UTSW 8 93268016 missense probably benign 0.00
R7323:Ces1f UTSW 8 93271844 missense probably damaging 1.00
R7654:Ces1f UTSW 8 93271934 missense probably benign 0.00
R7810:Ces1f UTSW 8 93256918 missense probably damaging 1.00
R7812:Ces1f UTSW 8 93258310 missense probably benign 0.00
R7864:Ces1f UTSW 8 93274141 missense possibly damaging 0.65
R7947:Ces1f UTSW 8 93274141 missense possibly damaging 0.65
R7999:Ces1f UTSW 8 93262995 missense possibly damaging 0.77
X0026:Ces1f UTSW 8 93270056 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AGCATCTCAGTTGGGCCATG -3'
(R):5'- GGGGTCTATGCTCCAGCTATTC -3'

Sequencing Primer
(F):5'- GCCATGCCAGAGAATGTTTC -3'
(R):5'- GCTATTCCCTTAGGACATAGCGAG -3'
Posted On2018-02-28