Mutagenetix > Incidental Mutation

Incidental Mutation 'R6256:Mst1r'

506122

Institutional Source

Beutler Lab

Gene Symbol

Mst1r

Ensembl Gene

ENSMUSG00000032584

Gene Name

macrophage stimulating 1 receptor (c-met-related tyrosine kinase)

Synonyms

Fv-2, Ron, CDw136, Fv2, friend virus susceptibility 2, PTK8, STK

MMRRC Submission

044373-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.250) question?

Stock #

R6256 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

107906873-107920383 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 107917266 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 1215 (Y1215N)

Ref Sequence

ENSEMBL: ENSMUSP00000035203 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035203] [ENSMUST00000195617]

AlphaFold

Q62190

Predicted Effect

probably damaging
Transcript: ENSMUST00000035203
AA Change: Y1215N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000035203
Gene: ENSMUSG00000032584
AA Change: Y1215N

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Sema	57	510	9.03e-116	SMART
PSI	528	570	8.72e-4	SMART
IPT	570	684	1.63e-18	SMART
IPT	685	769	4.03e-23	SMART
IPT	771	873	8.41e-12	SMART
IPT	878	972	5.36e0	SMART
TyrKc	1059	1318	8.2e-134	SMART
low complexity region	1349	1360	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194527

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195113

Predicted Effect

probably benign
Transcript: ENSMUST00000195617

SMART Domains

Protein: ENSMUSP00000142201
Gene: ENSMUSG00000032584

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Sema	57	442	3.5e-63	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.5%

Validation Efficiency

99% (74/75)

MGI Phenotype

FUNCTION: This gene encodes a precursor protein that is proteolytically cleaved to yield an alpha chain and a beta chain which form a membrane-spanning heterodimer. The encoded protein belongs to a family of cell-surface receptor tyrosine kinases involved in signaling from the cell surface to the intracellular environment. The binding of the encoded protein to its ligand, macrophage-stimulating protein, mediates several biological activities including wound healing, tumor immunity, macrophage activation and hematopoiesis as well as cell growth, motility, survival and adhesion. The protein encoded by this gene also functions in early development and the macrophage-mediated inflammatory response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: This locus controls susceptibility to splenomegaly or spleen focus formation induced by inoculation with Friend leukemia virus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030K09Rik	A	T	8: 72,451,428	Q361L	probably damaging	Het
Abca7	A	G	10: 80,002,622	T577A	probably damaging	Het
Acad12	A	T	5: 121,614,086	V54E	probably benign	Het
Ago4	A	G	4: 126,520,226	Y91H	probably damaging	Het
Akr1b10	T	C	6: 34,387,688	V28A	probably damaging	Het
Ccdc33	T	A	9: 58,101,918		probably null	Het
Ccdc7a	T	C	8: 128,935,593		probably null	Het
Ces1f	A	T	8: 93,265,794	V343E	probably damaging	Het
Cftr	T	C	6: 18,274,661	L896P	probably damaging	Het
Csmd3	G	A	15: 47,669,729	P2375S	probably damaging	Het
Dnajb14	G	C	3: 137,908,362	A345P	probably damaging	Het
Dnajb14	C	T	3: 137,908,363	A345V	probably damaging	Het
Dnase1	G	A	16: 4,037,621	R24K	probably benign	Het
Dnmbp	C	T	19: 43,852,281	V560M	probably damaging	Het
Dopey2	T	A	16: 93,807,214	I1981N	possibly damaging	Het
Eif3a	A	C	19: 60,771,026	S770A	possibly damaging	Het
Fbxl7	A	T	15: 26,553,002	C60S	probably benign	Het
Fras1	A	T	5: 96,733,843	D2478V	possibly damaging	Het
Hrnr	A	G	3: 93,322,611	D52G	probably damaging	Het
Jmjd1c	T	A	10: 67,220,408	L823M	probably damaging	Het
Kdm1a	G	T	4: 136,568,600	C172*	probably null	Het
Kdm6b	C	T	11: 69,406,729	E295K	probably damaging	Het
Mepe	A	T	5: 104,337,074	M27L	probably benign	Het
Mogat2	A	T	7: 99,219,895	H305Q	probably damaging	Het
Muc5ac	A	T	7: 141,789,795	H48L	possibly damaging	Het
Myo7b	T	C	18: 31,983,695	D953G	probably damaging	Het
Ocel1	T	C	8: 71,371,828		probably benign	Het
Pcdhb6	A	G	18: 37,335,925	D633G	probably damaging	Het
Ppm1l	A	G	3: 69,497,897	I176V	probably benign	Het
Sall3	C	T	18: 80,969,861	R1120H	possibly damaging	Het
Sbf1	G	A	15: 89,300,867	P1018S	probably benign	Het
Setbp1	T	C	18: 78,857,257	Y1065C	probably damaging	Het
Slc25a2	T	C	18: 37,637,723		probably null	Het
Slc4a2	C	A	5: 24,435,890	T729K	probably damaging	Het
Sptlc2	T	C	12: 87,355,531	E207G	probably damaging	Het
Sult6b1	A	T	17: 78,906,914	F27I	probably benign	Het
Syf2	A	T	4: 134,934,578	K84N	probably damaging	Het
Tmem209	A	T	6: 30,497,167	N183K	probably benign	Het
Tmem232	G	T	17: 65,478,402	Q188K	possibly damaging	Het
Tomm70a	A	T	16: 57,152,692	T598S	probably benign	Het
Ttll13	A	G	7: 80,258,304	T556A	probably benign	Het
Vmn2r120	A	T	17: 57,524,700	L363*	probably null	Het
Xpo6	G	T	7: 126,108,619	Q872K	probably damaging	Het
Xrra1	A	C	7: 99,914,464	S553R	probably damaging	Het
Zfy1	A	T	Y: 738,765	V147E	unknown	Homo
Zfy2	T	C	Y: 2,116,267	I258V	probably benign	Homo

Other mutations in Mst1r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Mst1r	APN	9	107913250	splice site	probably benign
IGL01327:Mst1r	APN	9	107907844	missense	probably benign	0.03
IGL01572:Mst1r	APN	9	107911592	missense	probably damaging	1.00
IGL01968:Mst1r	APN	9	107916806	splice site	probably null
IGL01983:Mst1r	APN	9	107917276	missense	probably damaging	0.99
IGL02096:Mst1r	APN	9	107917279	missense	probably damaging	0.97
IGL02203:Mst1r	APN	9	107913149	missense	possibly damaging	0.61
IGL02203:Mst1r	APN	9	107907869	missense	probably damaging	1.00
IGL02332:Mst1r	APN	9	107907826	nonsense	probably null
IGL02402:Mst1r	APN	9	107916827	missense	probably damaging	0.99
IGL02404:Mst1r	APN	9	107913067	splice site	probably benign
IGL02942:Mst1r	APN	9	107913153	missense	possibly damaging	0.89
IGL02951:Mst1r	APN	9	107908204	missense	possibly damaging	0.88
IGL02975:Mst1r	APN	9	107913180	missense	probably benign	0.20
IGL03005:Mst1r	APN	9	107914549	nonsense	probably null
IGL03304:Mst1r	APN	9	107907938	missense	probably damaging	1.00
R0386:Mst1r	UTSW	9	107916804	splice site	probably null
R0833:Mst1r	UTSW	9	107913167	missense	probably benign
R0833:Mst1r	UTSW	9	107914776	missense	probably benign	0.00
R1139:Mst1r	UTSW	9	107919969	missense	possibly damaging	0.93
R1371:Mst1r	UTSW	9	107917225	missense	probably damaging	1.00
R1477:Mst1r	UTSW	9	107908324	missense	probably benign
R1479:Mst1r	UTSW	9	107913345	splice site	probably benign
R1541:Mst1r	UTSW	9	107917363	missense	probably damaging	0.99
R1698:Mst1r	UTSW	9	107919980	missense	probably benign	0.06
R1891:Mst1r	UTSW	9	107913462	missense	probably damaging	1.00
R1971:Mst1r	UTSW	9	107913212	missense	probably benign	0.06
R1974:Mst1r	UTSW	9	107914763	missense	probably damaging	1.00
R1974:Mst1r	UTSW	9	107915933	critical splice donor site	probably null
R2144:Mst1r	UTSW	9	107913168	missense	probably benign
R2221:Mst1r	UTSW	9	107908348	missense	probably damaging	1.00
R2356:Mst1r	UTSW	9	107917870	missense	probably damaging	1.00
R3913:Mst1r	UTSW	9	107914746	missense	probably benign
R4768:Mst1r	UTSW	9	107911650	missense	probably damaging	1.00
R4793:Mst1r	UTSW	9	107919925	missense	probably damaging	0.96
R5141:Mst1r	UTSW	9	107912241	missense	probably damaging	0.99
R5191:Mst1r	UTSW	9	107911551	missense	probably damaging	0.98
R5238:Mst1r	UTSW	9	107907574	missense	probably damaging	1.00
R6024:Mst1r	UTSW	9	107908151	missense	probably benign	0.00
R6220:Mst1r	UTSW	9	107907348	missense	probably benign	0.11
R6361:Mst1r	UTSW	9	107915853	missense	probably benign
R6522:Mst1r	UTSW	9	107913239	missense	probably benign	0.00
R6559:Mst1r	UTSW	9	107908271	missense	possibly damaging	0.91
R6863:Mst1r	UTSW	9	107920026	missense	probably benign
R6868:Mst1r	UTSW	9	107915933	critical splice donor site	probably null
R6873:Mst1r	UTSW	9	107911644	missense	possibly damaging	0.90
R6978:Mst1r	UTSW	9	107912594	missense	probably benign	0.23
R7168:Mst1r	UTSW	9	107908193	missense	probably benign	0.01
R7299:Mst1r	UTSW	9	107914790	missense	possibly damaging	0.46
R7301:Mst1r	UTSW	9	107914790	missense	possibly damaging	0.46
R7405:Mst1r	UTSW	9	107915122	missense	possibly damaging	0.87
R7615:Mst1r	UTSW	9	107920012	missense	probably benign	0.05
R7684:Mst1r	UTSW	9	107911563	missense	probably benign	0.01
R7741:Mst1r	UTSW	9	107907120	start gained	probably benign
R7916:Mst1r	UTSW	9	107907578	missense	probably damaging	1.00
R7987:Mst1r	UTSW	9	107912798	splice site	probably null
R8177:Mst1r	UTSW	9	107907585	missense	probably damaging	1.00
R8356:Mst1r	UTSW	9	107917264	missense	probably damaging	1.00
R8494:Mst1r	UTSW	9	107914519	missense	possibly damaging	0.90
R8692:Mst1r	UTSW	9	107914851	missense	possibly damaging	0.82
R8979:Mst1r	UTSW	9	107915279	missense	probably damaging	0.98
R9012:Mst1r	UTSW	9	107914761	missense	probably benign	0.01
X0026:Mst1r	UTSW	9	107913203	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TGGTTCTTAAGGCCTTCGAAG -3'
(R):5'- TTGCCTAACTTGGGGAGTCTC -3'

Sequencing Primer
(F):5'- CTTCGAAGGACTTGGATCAGATC -3'
(R):5'- CTCTATGCTCGGATCATGCAGAAAAG -3'

Posted On

2018-02-28