Incidental Mutation 'R6256:Abca7'
ID506124
Institutional Source Beutler Lab
Gene Symbol Abca7
Ensembl Gene ENSMUSG00000035722
Gene NameATP-binding cassette, sub-family A (ABC1), member 7
SynonymsAbc51
MMRRC Submission 044373-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6256 (G1)
Quality Score198.009
Status Validated
Chromosome10
Chromosomal Location79996494-80015572 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80002622 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 577 (T577A)
Ref Sequence ENSEMBL: ENSMUSP00000128121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043866] [ENSMUST00000132517] [ENSMUST00000171637]
Predicted Effect probably damaging
Transcript: ENSMUST00000043866
AA Change: T577A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043090
Gene: ENSMUSG00000035722
AA Change: T577A

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 515 747 1.1e-17 PFAM
AAA 830 1011 4.97e-12 SMART
low complexity region 1136 1147 N/A INTRINSIC
transmembrane domain 1241 1263 N/A INTRINSIC
low complexity region 1299 1309 N/A INTRINSIC
low complexity region 1374 1390 N/A INTRINSIC
Pfam:ABC2_membrane_3 1427 1764 9e-43 PFAM
AAA 1833 2018 7.2e-9 SMART
low complexity region 2120 2135 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132517
AA Change: T577A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115111
Gene: ENSMUSG00000035722
AA Change: T577A

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 515 747 1.1e-17 PFAM
AAA 830 1011 4.97e-12 SMART
low complexity region 1136 1147 N/A INTRINSIC
transmembrane domain 1241 1263 N/A INTRINSIC
low complexity region 1299 1309 N/A INTRINSIC
low complexity region 1374 1390 N/A INTRINSIC
Pfam:ABC2_membrane_3 1427 1764 9e-43 PFAM
AAA 1833 2018 7.2e-9 SMART
low complexity region 2120 2135 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171637
AA Change: T577A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128121
Gene: ENSMUSG00000035722
AA Change: T577A

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 517 747 2.8e-19 PFAM
AAA 830 1011 4.97e-12 SMART
low complexity region 1136 1147 N/A INTRINSIC
transmembrane domain 1249 1271 N/A INTRINSIC
low complexity region 1307 1317 N/A INTRINSIC
low complexity region 1382 1398 N/A INTRINSIC
Pfam:ABC2_membrane_3 1426 1772 3.9e-47 PFAM
AAA 1841 2026 7.2e-9 SMART
low complexity region 2128 2143 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein is widely expressed with highest detection in spleen and hematopoietic tissues. Defects in this gene cause an increase in amyloid-beta deposits in a mouse model of Alzheimer's disease, and a related human protein is thought to play a role in lipid homeostasis in cells of the immune system. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous mutant females, but not males, have less white fat and lower total serum and HDL cholesterol levels. Males exhibit a 10% reduction in kidney size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A T 8: 72,451,428 Q361L probably damaging Het
Acad12 A T 5: 121,614,086 V54E probably benign Het
Ago4 A G 4: 126,520,226 Y91H probably damaging Het
Akr1b10 T C 6: 34,387,688 V28A probably damaging Het
Ccdc33 T A 9: 58,101,918 probably null Het
Ccdc7a T C 8: 128,935,593 probably null Het
Ces1f A T 8: 93,265,794 V343E probably damaging Het
Cftr T C 6: 18,274,661 L896P probably damaging Het
Csmd3 G A 15: 47,669,729 P2375S probably damaging Het
Dnajb14 G C 3: 137,908,362 A345P probably damaging Het
Dnajb14 C T 3: 137,908,363 A345V probably damaging Het
Dnase1 G A 16: 4,037,621 R24K probably benign Het
Dnmbp C T 19: 43,852,281 V560M probably damaging Het
Dopey2 T A 16: 93,807,214 I1981N possibly damaging Het
Eif3a A C 19: 60,771,026 S770A possibly damaging Het
Fbxl7 A T 15: 26,553,002 C60S probably benign Het
Fras1 A T 5: 96,733,843 D2478V possibly damaging Het
Hrnr A G 3: 93,322,611 D52G probably damaging Het
Jmjd1c T A 10: 67,220,408 L823M probably damaging Het
Kdm1a G T 4: 136,568,600 C172* probably null Het
Kdm6b C T 11: 69,406,729 E295K probably damaging Het
Mepe A T 5: 104,337,074 M27L probably benign Het
Mogat2 A T 7: 99,219,895 H305Q probably damaging Het
Mst1r T A 9: 107,917,266 Y1215N probably damaging Het
Muc5ac A T 7: 141,789,795 H48L possibly damaging Het
Myo7b T C 18: 31,983,695 D953G probably damaging Het
Ocel1 T C 8: 71,371,828 probably benign Het
Pcdhb6 A G 18: 37,335,925 D633G probably damaging Het
Ppm1l A G 3: 69,497,897 I176V probably benign Het
Sall3 C T 18: 80,969,861 R1120H possibly damaging Het
Sbf1 G A 15: 89,300,867 P1018S probably benign Het
Setbp1 T C 18: 78,857,257 Y1065C probably damaging Het
Slc25a2 T C 18: 37,637,723 probably null Het
Slc4a2 C A 5: 24,435,890 T729K probably damaging Het
Sptlc2 T C 12: 87,355,531 E207G probably damaging Het
Sult6b1 A T 17: 78,906,914 F27I probably benign Het
Syf2 A T 4: 134,934,578 K84N probably damaging Het
Tmem209 A T 6: 30,497,167 N183K probably benign Het
Tmem232 G T 17: 65,478,402 Q188K possibly damaging Het
Tomm70a A T 16: 57,152,692 T598S probably benign Het
Ttll13 A G 7: 80,258,304 T556A probably benign Het
Vmn2r120 A T 17: 57,524,700 L363* probably null Het
Xpo6 G T 7: 126,108,619 Q872K probably damaging Het
Xrra1 A C 7: 99,914,464 S553R probably damaging Het
Zfy1 A T Y: 738,765 V147E unknown Homo
Zfy2 T C Y: 2,116,267 I258V probably benign Homo
Other mutations in Abca7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Abca7 APN 10 80011297 missense probably damaging 0.96
IGL01074:Abca7 APN 10 80013892 missense possibly damaging 0.88
IGL01313:Abca7 APN 10 80003123 splice site probably benign
IGL01372:Abca7 APN 10 80006255 missense probably benign 0.00
IGL01387:Abca7 APN 10 79999762 missense possibly damaging 0.71
IGL01468:Abca7 APN 10 80003877 missense probably benign 0.21
IGL01648:Abca7 APN 10 80011080 missense probably damaging 1.00
IGL01796:Abca7 APN 10 80013909 missense probably damaging 0.99
IGL01977:Abca7 APN 10 80006152 missense probably benign 0.31
IGL01982:Abca7 APN 10 80002641 missense probably damaging 1.00
IGL02115:Abca7 APN 10 79998079 missense probably damaging 1.00
IGL02437:Abca7 APN 10 80008389 missense probably damaging 1.00
IGL02721:Abca7 APN 10 80013635 missense possibly damaging 0.93
IGL02812:Abca7 APN 10 80006047 missense possibly damaging 0.84
IGL02823:Abca7 APN 10 80008822 missense probably damaging 1.00
IGL02827:Abca7 APN 10 80009865 missense probably damaging 1.00
IGL02897:Abca7 APN 10 80001592 missense probably damaging 1.00
IGL02952:Abca7 APN 10 80007408 missense probably damaging 1.00
R0507:Abca7 UTSW 10 80002821 splice site probably benign
R0528:Abca7 UTSW 10 80003014 missense probably damaging 1.00
R0541:Abca7 UTSW 10 80007351 missense probably benign 0.01
R0584:Abca7 UTSW 10 80011730 missense probably damaging 1.00
R1018:Abca7 UTSW 10 80001491 missense probably damaging 1.00
R1099:Abca7 UTSW 10 80013743 nonsense probably null
R1520:Abca7 UTSW 10 80008830 missense possibly damaging 0.69
R1536:Abca7 UTSW 10 80014230 missense probably benign 0.39
R1619:Abca7 UTSW 10 80009055 missense probably damaging 1.00
R1636:Abca7 UTSW 10 80008998 missense probably benign
R1752:Abca7 UTSW 10 80006634 missense probably benign 0.17
R1762:Abca7 UTSW 10 79999765 missense probably damaging 1.00
R1764:Abca7 UTSW 10 80008950 missense probably damaging 1.00
R1891:Abca7 UTSW 10 80005040 missense possibly damaging 0.72
R1911:Abca7 UTSW 10 80006634 missense probably benign 0.17
R2032:Abca7 UTSW 10 80008237 missense probably damaging 1.00
R2188:Abca7 UTSW 10 80002533 missense probably damaging 1.00
R2973:Abca7 UTSW 10 80008967 missense probably damaging 1.00
R2974:Abca7 UTSW 10 80008967 missense probably damaging 1.00
R3055:Abca7 UTSW 10 79999747 missense probably damaging 1.00
R4496:Abca7 UTSW 10 80002934 missense probably damaging 1.00
R4570:Abca7 UTSW 10 80006694 missense probably damaging 1.00
R4581:Abca7 UTSW 10 80006568 missense probably benign 0.03
R4588:Abca7 UTSW 10 79997867 splice site probably null
R4628:Abca7 UTSW 10 80015188 critical splice donor site probably null
R4641:Abca7 UTSW 10 80005781 critical splice donor site probably null
R4888:Abca7 UTSW 10 80002728 missense probably damaging 0.97
R4911:Abca7 UTSW 10 80012188 critical splice donor site probably null
R4979:Abca7 UTSW 10 80004783 nonsense probably null
R4997:Abca7 UTSW 10 80007320 missense possibly damaging 0.90
R5147:Abca7 UTSW 10 80015315 missense probably benign 0.02
R5176:Abca7 UTSW 10 79998289 missense probably benign 0.35
R5190:Abca7 UTSW 10 79999593 critical splice donor site probably null
R5358:Abca7 UTSW 10 80013331 missense probably damaging 0.99
R5409:Abca7 UTSW 10 80014320 missense probably damaging 1.00
R5705:Abca7 UTSW 10 80015442 missense probably benign
R6246:Abca7 UTSW 10 80015165 missense probably damaging 1.00
R6260:Abca7 UTSW 10 80008987 missense probably damaging 1.00
R6275:Abca7 UTSW 10 79997791 missense probably damaging 1.00
R6277:Abca7 UTSW 10 80006158 missense probably benign 0.04
R6284:Abca7 UTSW 10 80004410 missense probably benign
R6307:Abca7 UTSW 10 80007387 missense probably damaging 1.00
R6451:Abca7 UTSW 10 80006899 missense probably damaging 0.99
R6456:Abca7 UTSW 10 80015150 missense probably null 0.69
R6460:Abca7 UTSW 10 80009028 missense probably benign 0.04
R6560:Abca7 UTSW 10 80007396 missense probably damaging 1.00
R6565:Abca7 UTSW 10 80011788 missense probably damaging 1.00
R6644:Abca7 UTSW 10 80008764 missense probably damaging 0.98
R6814:Abca7 UTSW 10 80002999 missense probably damaging 1.00
R7289:Abca7 UTSW 10 80009944 missense probably damaging 1.00
R7303:Abca7 UTSW 10 80014988 missense probably benign 0.17
R7493:Abca7 UTSW 10 80002062 missense probably damaging 0.96
R7535:Abca7 UTSW 10 80001629 missense probably benign 0.04
R7602:Abca7 UTSW 10 79998012 critical splice acceptor site probably null
R7607:Abca7 UTSW 10 80011833 missense probably damaging 1.00
R7647:Abca7 UTSW 10 80000822 missense probably benign 0.00
R7821:Abca7 UTSW 10 80002590 small deletion probably benign
R7863:Abca7 UTSW 10 80008821 missense probably damaging 1.00
R7896:Abca7 UTSW 10 80004958 missense probably damaging 1.00
R7911:Abca7 UTSW 10 80005033 missense probably benign 0.00
R7946:Abca7 UTSW 10 80008821 missense probably damaging 1.00
R7979:Abca7 UTSW 10 80004958 missense probably damaging 1.00
R7992:Abca7 UTSW 10 80005033 missense probably benign 0.00
Z1176:Abca7 UTSW 10 79999432 nonsense probably null
Z1176:Abca7 UTSW 10 80006559 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACATTTGTGCCACATGC -3'
(R):5'- CAGGATCCCGTTCCAAGATG -3'

Sequencing Primer
(F):5'- CATGCGTGTGTGCGTGTG -3'
(R):5'- CCCGTTCCAAGATGGGGGTTAG -3'
Posted On2018-02-28