Mutagenetix > Incidental Mutation

Incidental Mutation 'R6256:Kdm6b'

506132

Institutional Source

Beutler Lab

Gene Symbol

Kdm6b

Ensembl Gene

ENSMUSG00000018476

Gene Name

KDM1 lysine (K)-specific demethylase 6B

Synonyms

Jmjd3

MMRRC Submission

044373-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6256 (G1)

Quality Score

148.008

Status

Validated

Chromosome

Chromosomal Location

69398508-69413675 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 69406729 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 295 (E295K)

Ref Sequence

ENSEMBL: ENSMUSP00000091620 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094077]

AlphaFold

Q5NCY0

PDB Structure

The free structure of the mouse C-terminal domain of KDM6B [X-RAY DIFFRACTION]
free KDM6B structure [X-RAY DIFFRACTION]
the crystal structure of KDM6B bound with H3K27me3 peptide [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000094077
AA Change: E295K

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000091620
Gene: ENSMUSG00000018476
AA Change: E295K

Domain	Start	End	E-Value	Type
low complexity region	29	43	N/A	INTRINSIC
low complexity region	54	71	N/A	INTRINSIC
SCOP:d1elwa_	91	152	9e-5	SMART
low complexity region	214	227	N/A	INTRINSIC
low complexity region	239	270	N/A	INTRINSIC
low complexity region	312	329	N/A	INTRINSIC
low complexity region	333	345	N/A	INTRINSIC
low complexity region	389	415	N/A	INTRINSIC
low complexity region	461	487	N/A	INTRINSIC
low complexity region	515	524	N/A	INTRINSIC
low complexity region	544	577	N/A	INTRINSIC
low complexity region	585	615	N/A	INTRINSIC
low complexity region	643	650	N/A	INTRINSIC
low complexity region	711	719	N/A	INTRINSIC
low complexity region	743	766	N/A	INTRINSIC
low complexity region	771	811	N/A	INTRINSIC
low complexity region	840	879	N/A	INTRINSIC
low complexity region	890	909	N/A	INTRINSIC
low complexity region	950	989	N/A	INTRINSIC
low complexity region	993	1011	N/A	INTRINSIC
low complexity region	1044	1068	N/A	INTRINSIC
low complexity region	1284	1317	N/A	INTRINSIC
JmjC	1337	1500	1.61e-47	SMART
Blast:JmjC	1536	1600	1e-18	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129924

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156562

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.5%

Validation Efficiency

99% (74/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a lysine-specific demethylase that specifically demethylates di- or tri-methylated lysine 27 of histone H3 (H3K27me2 or H3K27me3). H3K27 trimethylation is a repressive epigenetic mark controlling chromatin organization and gene silencing. This protein can also demethylate non-histone proteins such as retinoblastoma protein. Through its demethylation actvity this gene influences cellular differentiation and development, tumorigenesis, inflammatory diseases, and neurodegenerative diseases. This protein has two classical nuclear localization signals at its N-terminus. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a null allele show perinatal death, thick alveolar septum, and absence of air space in the lungs. Mice homozygous for a different null allele die neonatally displaying abnormal lung development, dwarfism, kyphosis, short limbs, and a severe delay in endochondral ossification. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030K09Rik	A	T	8: 72,451,428	Q361L	probably damaging	Het
Abca7	A	G	10: 80,002,622	T577A	probably damaging	Het
Acad12	A	T	5: 121,614,086	V54E	probably benign	Het
Ago4	A	G	4: 126,520,226	Y91H	probably damaging	Het
Akr1b10	T	C	6: 34,387,688	V28A	probably damaging	Het
Ccdc33	T	A	9: 58,101,918		probably null	Het
Ccdc7a	T	C	8: 128,935,593		probably null	Het
Ces1f	A	T	8: 93,265,794	V343E	probably damaging	Het
Cftr	T	C	6: 18,274,661	L896P	probably damaging	Het
Csmd3	G	A	15: 47,669,729	P2375S	probably damaging	Het
Dnajb14	G	C	3: 137,908,362	A345P	probably damaging	Het
Dnajb14	C	T	3: 137,908,363	A345V	probably damaging	Het
Dnase1	G	A	16: 4,037,621	R24K	probably benign	Het
Dnmbp	C	T	19: 43,852,281	V560M	probably damaging	Het
Dopey2	T	A	16: 93,807,214	I1981N	possibly damaging	Het
Eif3a	A	C	19: 60,771,026	S770A	possibly damaging	Het
Fbxl7	A	T	15: 26,553,002	C60S	probably benign	Het
Fras1	A	T	5: 96,733,843	D2478V	possibly damaging	Het
Hrnr	A	G	3: 93,322,611	D52G	probably damaging	Het
Jmjd1c	T	A	10: 67,220,408	L823M	probably damaging	Het
Kdm1a	G	T	4: 136,568,600	C172*	probably null	Het
Mepe	A	T	5: 104,337,074	M27L	probably benign	Het
Mogat2	A	T	7: 99,219,895	H305Q	probably damaging	Het
Mst1r	T	A	9: 107,917,266	Y1215N	probably damaging	Het
Muc5ac	A	T	7: 141,789,795	H48L	possibly damaging	Het
Myo7b	T	C	18: 31,983,695	D953G	probably damaging	Het
Ocel1	T	C	8: 71,371,828		probably benign	Het
Pcdhb6	A	G	18: 37,335,925	D633G	probably damaging	Het
Ppm1l	A	G	3: 69,497,897	I176V	probably benign	Het
Sall3	C	T	18: 80,969,861	R1120H	possibly damaging	Het
Sbf1	G	A	15: 89,300,867	P1018S	probably benign	Het
Setbp1	T	C	18: 78,857,257	Y1065C	probably damaging	Het
Slc25a2	T	C	18: 37,637,723		probably null	Het
Slc4a2	C	A	5: 24,435,890	T729K	probably damaging	Het
Sptlc2	T	C	12: 87,355,531	E207G	probably damaging	Het
Sult6b1	A	T	17: 78,906,914	F27I	probably benign	Het
Syf2	A	T	4: 134,934,578	K84N	probably damaging	Het
Tmem209	A	T	6: 30,497,167	N183K	probably benign	Het
Tmem232	G	T	17: 65,478,402	Q188K	possibly damaging	Het
Tomm70a	A	T	16: 57,152,692	T598S	probably benign	Het
Ttll13	A	G	7: 80,258,304	T556A	probably benign	Het
Vmn2r120	A	T	17: 57,524,700	L363*	probably null	Het
Xpo6	G	T	7: 126,108,619	Q872K	probably damaging	Het
Xrra1	A	C	7: 99,914,464	S553R	probably damaging	Het
Zfy1	A	T	Y: 738,765	V147E	unknown	Homo
Zfy2	T	C	Y: 2,116,267	I258V	probably benign	Homo

Other mutations in Kdm6b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Kdm6b	APN	11	69406306	missense	possibly damaging	0.85
IGL02271:Kdm6b	APN	11	69406067	missense	possibly damaging	0.65
beine	UTSW	11	69403592	missense	unknown
Gaudy	UTSW	11	69400206	missense	unknown
Hypocrisy	UTSW	11	69402151	nonsense	probably null
Knochen	UTSW	11	69400055	unclassified	probably benign
Ostentatious	UTSW	11	69403598	missense	unknown
Piquant	UTSW	11	69403794	missense	unknown
preen	UTSW	11	69402093	missense	unknown
Tart	UTSW	11	69406366	missense	probably damaging	1.00
BB007:Kdm6b	UTSW	11	69399952	missense	unknown
BB017:Kdm6b	UTSW	11	69399952	missense	unknown
PIT4458001:Kdm6b	UTSW	11	69399952	missense	unknown
R0455:Kdm6b	UTSW	11	69406996	nonsense	probably null
R0645:Kdm6b	UTSW	11	69405018	missense	unknown
R1659:Kdm6b	UTSW	11	69407588	missense	possibly damaging	0.88
R1855:Kdm6b	UTSW	11	69407286	missense	probably damaging	0.99
R1962:Kdm6b	UTSW	11	69401365	unclassified	probably benign
R1993:Kdm6b	UTSW	11	69406303	missense	probably null	0.85
R2029:Kdm6b	UTSW	11	69403592	missense	unknown
R2181:Kdm6b	UTSW	11	69401126	nonsense	probably null
R2215:Kdm6b	UTSW	11	69405044	missense	unknown
R2904:Kdm6b	UTSW	11	69405785	missense	possibly damaging	0.63
R2992:Kdm6b	UTSW	11	69406307	small deletion	probably benign
R3236:Kdm6b	UTSW	11	69406366	missense	probably damaging	1.00
R3950:Kdm6b	UTSW	11	69405615	missense	probably damaging	1.00
R4027:Kdm6b	UTSW	11	69406268	missense	possibly damaging	0.92
R4830:Kdm6b	UTSW	11	69403794	missense	unknown
R4996:Kdm6b	UTSW	11	69405731	missense	probably damaging	1.00
R5034:Kdm6b	UTSW	11	69401910	splice site	probably benign
R5140:Kdm6b	UTSW	11	69400055	unclassified	probably benign
R5160:Kdm6b	UTSW	11	69400768	unclassified	probably benign
R5240:Kdm6b	UTSW	11	69401904	splice site	probably benign
R5273:Kdm6b	UTSW	11	69404201	missense	unknown
R5386:Kdm6b	UTSW	11	69400810	unclassified	probably benign
R5597:Kdm6b	UTSW	11	69406074	missense	probably damaging	0.96
R5598:Kdm6b	UTSW	11	69406074	missense	probably damaging	0.96
R5812:Kdm6b	UTSW	11	69405929	missense	probably damaging	0.98
R5976:Kdm6b	UTSW	11	69403788	critical splice donor site	probably null
R6000:Kdm6b	UTSW	11	69403598	missense	unknown
R6145:Kdm6b	UTSW	11	69405026	missense	unknown
R6191:Kdm6b	UTSW	11	69406758	missense	probably benign	0.01
R6304:Kdm6b	UTSW	11	69404258	missense	unknown
R6917:Kdm6b	UTSW	11	69406593	missense	probably benign	0.04
R6939:Kdm6b	UTSW	11	69406762	missense	probably damaging	0.99
R7356:Kdm6b	UTSW	11	69402165	nonsense	probably null
R7644:Kdm6b	UTSW	11	69400206	missense	unknown
R7673:Kdm6b	UTSW	11	69405742	missense	probably damaging	0.98
R7698:Kdm6b	UTSW	11	69405981	missense	probably benign	0.14
R7776:Kdm6b	UTSW	11	69406134	missense	possibly damaging	0.84
R7930:Kdm6b	UTSW	11	69399952	missense	unknown
R8383:Kdm6b	UTSW	11	69406050	missense	probably benign
R8725:Kdm6b	UTSW	11	69402093	missense	unknown
R8727:Kdm6b	UTSW	11	69402093	missense	unknown
R8813:Kdm6b	UTSW	11	69406829	small insertion	probably benign
R8813:Kdm6b	UTSW	11	69406832	small insertion	probably benign
R8851:Kdm6b	UTSW	11	69401167	missense	unknown
R9074:Kdm6b	UTSW	11	69402151	nonsense	probably null
R9130:Kdm6b	UTSW	11	69404598	missense	unknown
R9179:Kdm6b	UTSW	11	69406695	critical splice donor site	probably null
R9535:Kdm6b	UTSW	11	69406450	nonsense	probably null
Z1177:Kdm6b	UTSW	11	69403866	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TCTCTAAGGTCACTTCCGGG -3'
(R):5'- GGGCAAGGAGTAGGATTTTCAC -3'

Sequencing Primer
(F):5'- ATGGCTCTCTGCTCCTGGG -3'
(R):5'- GCAAGGAGTAGGATTTTCACTTTCTC -3'

Posted On

2018-02-28