Incidental Mutation 'R6256:Sptlc2'
ID506137
Institutional Source Beutler Lab
Gene Symbol Sptlc2
Ensembl Gene ENSMUSG00000021036
Gene Nameserine palmitoyltransferase, long chain base subunit 2
SynonymsLCB2
MMRRC Submission 044373-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6256 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location87305058-87388355 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87355531 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 207 (E207G)
Ref Sequence ENSEMBL: ENSMUSP00000021424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021424]
Predicted Effect probably damaging
Transcript: ENSMUST00000021424
AA Change: E207G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021424
Gene: ENSMUSG00000021036
AA Change: E207G

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 166 526 7.2e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167911
Meta Mutation Damage Score 0.5307 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: This gene encodes a long chain base subunit of serine palmitoyltransferase. The enzyme, serine palmitoyltransferase, consists of two different subunits, and is the key enzyme in sphingolipid biosynthesis. It catalyzes the pyridoxal-5-prime-phosphate-dependent condensation of L-serine and palmitoyl-CoA to 3-oxosphinganine. A mutant allele of this gene in mice is used as a model for the human disease 'Susceptibilty to Psoriasis 1'. Mutations in the human gene are associated with hereditary sensory neuropathy type I. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice heterozygous for this allele exhibit abnormal liver and circulating shingolipid levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A T 8: 72,451,428 Q361L probably damaging Het
Abca7 A G 10: 80,002,622 T577A probably damaging Het
Acad12 A T 5: 121,614,086 V54E probably benign Het
Ago4 A G 4: 126,520,226 Y91H probably damaging Het
Akr1b10 T C 6: 34,387,688 V28A probably damaging Het
Ccdc33 T A 9: 58,101,918 probably null Het
Ccdc7a T C 8: 128,935,593 probably null Het
Ces1f A T 8: 93,265,794 V343E probably damaging Het
Cftr T C 6: 18,274,661 L896P probably damaging Het
Csmd3 G A 15: 47,669,729 P2375S probably damaging Het
Dnajb14 G C 3: 137,908,362 A345P probably damaging Het
Dnajb14 C T 3: 137,908,363 A345V probably damaging Het
Dnase1 G A 16: 4,037,621 R24K probably benign Het
Dnmbp C T 19: 43,852,281 V560M probably damaging Het
Dopey2 T A 16: 93,807,214 I1981N possibly damaging Het
Eif3a A C 19: 60,771,026 S770A possibly damaging Het
Fbxl7 A T 15: 26,553,002 C60S probably benign Het
Fras1 A T 5: 96,733,843 D2478V possibly damaging Het
Hrnr A G 3: 93,322,611 D52G probably damaging Het
Jmjd1c T A 10: 67,220,408 L823M probably damaging Het
Kdm1a G T 4: 136,568,600 C172* probably null Het
Kdm6b C T 11: 69,406,729 E295K probably damaging Het
Mepe A T 5: 104,337,074 M27L probably benign Het
Mogat2 A T 7: 99,219,895 H305Q probably damaging Het
Mst1r T A 9: 107,917,266 Y1215N probably damaging Het
Muc5ac A T 7: 141,789,795 H48L possibly damaging Het
Myo7b T C 18: 31,983,695 D953G probably damaging Het
Ocel1 T C 8: 71,371,828 probably benign Het
Pcdhb6 A G 18: 37,335,925 D633G probably damaging Het
Ppm1l A G 3: 69,497,897 I176V probably benign Het
Sall3 C T 18: 80,969,861 R1120H possibly damaging Het
Sbf1 G A 15: 89,300,867 P1018S probably benign Het
Setbp1 T C 18: 78,857,257 Y1065C probably damaging Het
Slc25a2 T C 18: 37,637,723 probably null Het
Slc4a2 C A 5: 24,435,890 T729K probably damaging Het
Sult6b1 A T 17: 78,906,914 F27I probably benign Het
Syf2 A T 4: 134,934,578 K84N probably damaging Het
Tmem209 A T 6: 30,497,167 N183K probably benign Het
Tmem232 G T 17: 65,478,402 Q188K possibly damaging Het
Tomm70a A T 16: 57,152,692 T598S probably benign Het
Ttll13 A G 7: 80,258,304 T556A probably benign Het
Vmn2r120 A T 17: 57,524,700 L363* probably null Het
Xpo6 G T 7: 126,108,619 Q872K probably damaging Het
Xrra1 A C 7: 99,914,464 S553R probably damaging Het
Zfy1 A T Y: 738,765 V147E unknown Homo
Zfy2 T C Y: 2,116,267 I258V probably benign Homo
Other mutations in Sptlc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Sptlc2 APN 12 87369068 missense probably damaging 0.99
IGL02458:Sptlc2 APN 12 87309893 utr 3 prime probably benign
IGL02734:Sptlc2 APN 12 87355670 missense probably damaging 0.97
IGL03252:Sptlc2 APN 12 87355657 missense probably benign 0.00
lopsided UTSW 12 87341565 missense probably benign 0.27
shinola UTSW 12 87350295 missense possibly damaging 0.64
R0087:Sptlc2 UTSW 12 87369118 missense probably benign
R0116:Sptlc2 UTSW 12 87356680 missense probably benign 0.00
R0492:Sptlc2 UTSW 12 87346806 splice site probably null
R1353:Sptlc2 UTSW 12 87341746 missense probably damaging 1.00
R1470:Sptlc2 UTSW 12 87355640 missense probably benign 0.00
R1470:Sptlc2 UTSW 12 87355640 missense probably benign 0.00
R3417:Sptlc2 UTSW 12 87346808 splice site probably benign
R3735:Sptlc2 UTSW 12 87341565 missense probably benign 0.27
R3736:Sptlc2 UTSW 12 87341565 missense probably benign 0.27
R4278:Sptlc2 UTSW 12 87336151 missense probably benign 0.04
R5252:Sptlc2 UTSW 12 87336055 missense possibly damaging 0.49
R5593:Sptlc2 UTSW 12 87369083 missense probably benign 0.11
R5656:Sptlc2 UTSW 12 87346761 missense probably damaging 1.00
R5801:Sptlc2 UTSW 12 87341771 splice site probably null
R6280:Sptlc2 UTSW 12 87388131 missense probably benign
R6520:Sptlc2 UTSW 12 87355662 missense probably benign
R6808:Sptlc2 UTSW 12 87350295 missense possibly damaging 0.64
R7133:Sptlc2 UTSW 12 87350377 missense probably benign 0.00
R7274:Sptlc2 UTSW 12 87341606 missense probably benign 0.24
R7366:Sptlc2 UTSW 12 87314049 critical splice donor site probably null
R7602:Sptlc2 UTSW 12 87341689 missense probably damaging 0.99
Z1177:Sptlc2 UTSW 12 87369044 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACCCATGTAATAAGTGGCACTTG -3'
(R):5'- ACACTTGGGTATTAGGCATGATTG -3'

Sequencing Primer
(F):5'- AAGACAGTGTCTGCTGGA -3'
(R):5'- CACAGGTACACAGGGAAT -3'
Posted On2018-02-28