Mutagenetix > Incidental Mutation

Incidental Mutation 'R6256:Sptlc2'

506137

Institutional Source

Beutler Lab

Gene Symbol

Sptlc2

Ensembl Gene

ENSMUSG00000021036

Gene Name

serine palmitoyltransferase, long chain base subunit 2

Synonyms

LCB2

MMRRC Submission

044373-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6256 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

87305058-87388355 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 87355531 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 207 (E207G)

Ref Sequence

ENSEMBL: ENSMUSP00000021424 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021424]

AlphaFold

P97363

Predicted Effect

probably damaging
Transcript: ENSMUST00000021424
AA Change: E207G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000021424
Gene: ENSMUSG00000021036
AA Change: E207G

Domain	Start	End	E-Value	Type
Pfam:Aminotran_1_2	166	526	7.2e-60	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167911

Meta Mutation Damage Score

0.5307

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.5%

Validation Efficiency

99% (74/75)

MGI Phenotype

FUNCTION: This gene encodes a long chain base subunit of serine palmitoyltransferase. The enzyme, serine palmitoyltransferase, consists of two different subunits, and is the key enzyme in sphingolipid biosynthesis. It catalyzes the pyridoxal-5-prime-phosphate-dependent condensation of L-serine and palmitoyl-CoA to 3-oxosphinganine. A mutant allele of this gene in mice is used as a model for the human disease 'Susceptibilty to Psoriasis 1'. Mutations in the human gene are associated with hereditary sensory neuropathy type I. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice heterozygous for this allele exhibit abnormal liver and circulating shingolipid levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030K09Rik	A	T	8: 72,451,428	Q361L	probably damaging	Het
Abca7	A	G	10: 80,002,622	T577A	probably damaging	Het
Acad12	A	T	5: 121,614,086	V54E	probably benign	Het
Ago4	A	G	4: 126,520,226	Y91H	probably damaging	Het
Akr1b10	T	C	6: 34,387,688	V28A	probably damaging	Het
Ccdc33	T	A	9: 58,101,918		probably null	Het
Ccdc7a	T	C	8: 128,935,593		probably null	Het
Ces1f	A	T	8: 93,265,794	V343E	probably damaging	Het
Cftr	T	C	6: 18,274,661	L896P	probably damaging	Het
Csmd3	G	A	15: 47,669,729	P2375S	probably damaging	Het
Dnajb14	G	C	3: 137,908,362	A345P	probably damaging	Het
Dnajb14	C	T	3: 137,908,363	A345V	probably damaging	Het
Dnase1	G	A	16: 4,037,621	R24K	probably benign	Het
Dnmbp	C	T	19: 43,852,281	V560M	probably damaging	Het
Dopey2	T	A	16: 93,807,214	I1981N	possibly damaging	Het
Eif3a	A	C	19: 60,771,026	S770A	possibly damaging	Het
Fbxl7	A	T	15: 26,553,002	C60S	probably benign	Het
Fras1	A	T	5: 96,733,843	D2478V	possibly damaging	Het
Hrnr	A	G	3: 93,322,611	D52G	probably damaging	Het
Jmjd1c	T	A	10: 67,220,408	L823M	probably damaging	Het
Kdm1a	G	T	4: 136,568,600	C172*	probably null	Het
Kdm6b	C	T	11: 69,406,729	E295K	probably damaging	Het
Mepe	A	T	5: 104,337,074	M27L	probably benign	Het
Mogat2	A	T	7: 99,219,895	H305Q	probably damaging	Het
Mst1r	T	A	9: 107,917,266	Y1215N	probably damaging	Het
Muc5ac	A	T	7: 141,789,795	H48L	possibly damaging	Het
Myo7b	T	C	18: 31,983,695	D953G	probably damaging	Het
Ocel1	T	C	8: 71,371,828		probably benign	Het
Pcdhb6	A	G	18: 37,335,925	D633G	probably damaging	Het
Ppm1l	A	G	3: 69,497,897	I176V	probably benign	Het
Sall3	C	T	18: 80,969,861	R1120H	possibly damaging	Het
Sbf1	G	A	15: 89,300,867	P1018S	probably benign	Het
Setbp1	T	C	18: 78,857,257	Y1065C	probably damaging	Het
Slc25a2	T	C	18: 37,637,723		probably null	Het
Slc4a2	C	A	5: 24,435,890	T729K	probably damaging	Het
Sult6b1	A	T	17: 78,906,914	F27I	probably benign	Het
Syf2	A	T	4: 134,934,578	K84N	probably damaging	Het
Tmem209	A	T	6: 30,497,167	N183K	probably benign	Het
Tmem232	G	T	17: 65,478,402	Q188K	possibly damaging	Het
Tomm70a	A	T	16: 57,152,692	T598S	probably benign	Het
Ttll13	A	G	7: 80,258,304	T556A	probably benign	Het
Vmn2r120	A	T	17: 57,524,700	L363*	probably null	Het
Xpo6	G	T	7: 126,108,619	Q872K	probably damaging	Het
Xrra1	A	C	7: 99,914,464	S553R	probably damaging	Het
Zfy1	A	T	Y: 738,765	V147E	unknown	Homo
Zfy2	T	C	Y: 2,116,267	I258V	probably benign	Homo

Other mutations in Sptlc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00757:Sptlc2	APN	12	87369068	missense	probably damaging	0.99
IGL02458:Sptlc2	APN	12	87309893	utr 3 prime	probably benign
IGL02734:Sptlc2	APN	12	87355670	missense	probably damaging	0.97
IGL03252:Sptlc2	APN	12	87355657	missense	probably benign	0.00
lopsided	UTSW	12	87341565	missense	probably benign	0.27
shinola	UTSW	12	87350295	missense	possibly damaging	0.64
R0087:Sptlc2	UTSW	12	87369118	missense	probably benign
R0116:Sptlc2	UTSW	12	87356680	missense	probably benign	0.00
R0492:Sptlc2	UTSW	12	87346806	splice site	probably null
R1353:Sptlc2	UTSW	12	87341746	missense	probably damaging	1.00
R1470:Sptlc2	UTSW	12	87355640	missense	probably benign	0.00
R1470:Sptlc2	UTSW	12	87355640	missense	probably benign	0.00
R3417:Sptlc2	UTSW	12	87346808	splice site	probably benign
R3735:Sptlc2	UTSW	12	87341565	missense	probably benign	0.27
R3736:Sptlc2	UTSW	12	87341565	missense	probably benign	0.27
R4278:Sptlc2	UTSW	12	87336151	missense	probably benign	0.04
R5252:Sptlc2	UTSW	12	87336055	missense	possibly damaging	0.49
R5593:Sptlc2	UTSW	12	87369083	missense	probably benign	0.11
R5656:Sptlc2	UTSW	12	87346761	missense	probably damaging	1.00
R5801:Sptlc2	UTSW	12	87341771	splice site	probably null
R6280:Sptlc2	UTSW	12	87388131	missense	probably benign
R6520:Sptlc2	UTSW	12	87355662	missense	probably benign
R6808:Sptlc2	UTSW	12	87350295	missense	possibly damaging	0.64
R7133:Sptlc2	UTSW	12	87350377	missense	probably benign	0.00
R7274:Sptlc2	UTSW	12	87341606	missense	probably benign	0.24
R7366:Sptlc2	UTSW	12	87314049	critical splice donor site	probably null
R7602:Sptlc2	UTSW	12	87341689	missense	probably damaging	0.99
R9085:Sptlc2	UTSW	12	87336065	missense	probably benign	0.00
R9710:Sptlc2	UTSW	12	87312759	missense	probably benign	0.44
Z1177:Sptlc2	UTSW	12	87369044	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CACCCATGTAATAAGTGGCACTTG -3'
(R):5'- ACACTTGGGTATTAGGCATGATTG -3'

Sequencing Primer
(F):5'- AAGACAGTGTCTGCTGGA -3'
(R):5'- CACAGGTACACAGGGAAT -3'

Posted On

2018-02-28