Incidental Mutation 'R6256:Sbf1'
ID506141
Institutional Source Beutler Lab
Gene Symbol Sbf1
Ensembl Gene ENSMUSG00000036529
Gene NameSET binding factor 1
SynonymsB230113C15Rik, 2610510A08Rik, Mtmr5
MMRRC Submission 044373-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.380) question?
Stock #R6256 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location89288236-89315311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 89300867 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 1018 (P1018S)
Ref Sequence ENSEMBL: ENSMUSP00000118107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123791] [ENSMUST00000124576] [ENSMUST00000144585]
PDB Structure Solution Structure of the C-terminal Pleckstrin Homology Domain of Sbf1 from Mouse [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000123791
AA Change: P1018S

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000120725
Gene: ENSMUSG00000036529
AA Change: P1018S

DomainStartEndE-ValueType
uDENN 1 86 6.68e-31 SMART
DENN 128 310 4.05e-71 SMART
dDENN 363 432 1.28e-18 SMART
Pfam:SBF2 540 764 4.1e-110 PFAM
GRAM 882 968 3.93e-12 SMART
Pfam:Myotub-related 1100 1534 6.2e-114 PFAM
low complexity region 1614 1621 N/A INTRINSIC
low complexity region 1652 1666 N/A INTRINSIC
low complexity region 1719 1750 N/A INTRINSIC
PH 1762 1867 6.45e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124576
SMART Domains Protein: ENSMUSP00000115740
Gene: ENSMUSG00000036529

DomainStartEndE-ValueType
uDENN 1 86 6.68e-31 SMART
DENN 128 310 4.05e-71 SMART
Pfam:dDENN 363 403 4.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124642
SMART Domains Protein: ENSMUSP00000119943
Gene: ENSMUSG00000036529

DomainStartEndE-ValueType
Pfam:SBF2 1 94 1.2e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144585
AA Change: P1018S

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000118107
Gene: ENSMUSG00000036529
AA Change: P1018S

DomainStartEndE-ValueType
uDENN 1 86 6.68e-31 SMART
DENN 128 310 4.05e-71 SMART
dDENN 363 432 1.28e-18 SMART
Pfam:SBF2 542 764 2.3e-108 PFAM
GRAM 882 968 3.93e-12 SMART
Pfam:Myotub-related 1106 1558 5.7e-93 PFAM
low complexity region 1640 1647 N/A INTRINSIC
low complexity region 1678 1692 N/A INTRINSIC
low complexity region 1745 1776 N/A INTRINSIC
PH 1788 1893 6.45e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184827
Meta Mutation Damage Score 0.0705 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein-tyrosine phosphatase family. However, the encoded protein does not appear to be a catalytically active phosphatase because it lacks several amino acids in the catalytic pocket. This protein contains a Guanine nucleotide exchange factor (GEF) domain which is necessary for its role in growth and differentiation. Mutations in this gene have been associated with Charcot-Marie-Tooth disease 4B3. Pseudogenes of this gene have been defined on chromosomes 1 and 8. [provided by RefSeq, Dec 2014]
PHENOTYPE: Male homozygotes for a targeted null mutation exhibit male infertility associated with azoospermia, vacuolation of Sertoli cells, reduced spermatid formation, and eventual depletion of germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A T 8: 72,451,428 Q361L probably damaging Het
Abca7 A G 10: 80,002,622 T577A probably damaging Het
Acad12 A T 5: 121,614,086 V54E probably benign Het
Ago4 A G 4: 126,520,226 Y91H probably damaging Het
Akr1b10 T C 6: 34,387,688 V28A probably damaging Het
Ccdc33 T A 9: 58,101,918 probably null Het
Ccdc7a T C 8: 128,935,593 probably null Het
Ces1f A T 8: 93,265,794 V343E probably damaging Het
Cftr T C 6: 18,274,661 L896P probably damaging Het
Csmd3 G A 15: 47,669,729 P2375S probably damaging Het
Dnajb14 G C 3: 137,908,362 A345P probably damaging Het
Dnajb14 C T 3: 137,908,363 A345V probably damaging Het
Dnase1 G A 16: 4,037,621 R24K probably benign Het
Dnmbp C T 19: 43,852,281 V560M probably damaging Het
Dopey2 T A 16: 93,807,214 I1981N possibly damaging Het
Eif3a A C 19: 60,771,026 S770A possibly damaging Het
Fbxl7 A T 15: 26,553,002 C60S probably benign Het
Fras1 A T 5: 96,733,843 D2478V possibly damaging Het
Hrnr A G 3: 93,322,611 D52G probably damaging Het
Jmjd1c T A 10: 67,220,408 L823M probably damaging Het
Kdm1a G T 4: 136,568,600 C172* probably null Het
Kdm6b C T 11: 69,406,729 E295K probably damaging Het
Mepe A T 5: 104,337,074 M27L probably benign Het
Mogat2 A T 7: 99,219,895 H305Q probably damaging Het
Mst1r T A 9: 107,917,266 Y1215N probably damaging Het
Muc5ac A T 7: 141,789,795 H48L possibly damaging Het
Myo7b T C 18: 31,983,695 D953G probably damaging Het
Ocel1 T C 8: 71,371,828 probably benign Het
Pcdhb6 A G 18: 37,335,925 D633G probably damaging Het
Ppm1l A G 3: 69,497,897 I176V probably benign Het
Sall3 C T 18: 80,969,861 R1120H possibly damaging Het
Setbp1 T C 18: 78,857,257 Y1065C probably damaging Het
Slc25a2 T C 18: 37,637,723 probably null Het
Slc4a2 C A 5: 24,435,890 T729K probably damaging Het
Sptlc2 T C 12: 87,355,531 E207G probably damaging Het
Sult6b1 A T 17: 78,906,914 F27I probably benign Het
Syf2 A T 4: 134,934,578 K84N probably damaging Het
Tmem209 A T 6: 30,497,167 N183K probably benign Het
Tmem232 G T 17: 65,478,402 Q188K possibly damaging Het
Tomm70a A T 16: 57,152,692 T598S probably benign Het
Ttll13 A G 7: 80,258,304 T556A probably benign Het
Vmn2r120 A T 17: 57,524,700 L363* probably null Het
Xpo6 G T 7: 126,108,619 Q872K probably damaging Het
Xrra1 A C 7: 99,914,464 S553R probably damaging Het
Zfy1 A T Y: 738,765 V147E unknown Homo
Zfy2 T C Y: 2,116,267 I258V probably benign Homo
Other mutations in Sbf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00265:Sbf1 APN 15 89305575 missense probably damaging 0.98
IGL01478:Sbf1 APN 15 89299743 missense probably damaging 0.97
IGL01533:Sbf1 APN 15 89288716 missense probably damaging 0.99
IGL01603:Sbf1 APN 15 89303278 missense probably damaging 1.00
IGL01758:Sbf1 APN 15 89303215 unclassified probably benign
IGL01908:Sbf1 APN 15 89302726 missense probably damaging 1.00
IGL02067:Sbf1 APN 15 89289044 missense probably damaging 1.00
IGL02089:Sbf1 APN 15 89302505 nonsense probably null
IGL02150:Sbf1 APN 15 89295480 missense probably benign 0.00
IGL02284:Sbf1 APN 15 89305078 missense probably damaging 1.00
IGL02367:Sbf1 APN 15 89307572 missense probably damaging 0.99
IGL02427:Sbf1 APN 15 89305985 unclassified probably benign
IGL03025:Sbf1 APN 15 89289645 missense probably damaging 1.00
IGL03103:Sbf1 APN 15 89293947 missense probably damaging 1.00
IGL03226:Sbf1 APN 15 89289105 missense possibly damaging 0.93
IGL03376:Sbf1 APN 15 89289016 unclassified probably benign
IGL03397:Sbf1 APN 15 89288721 missense probably damaging 1.00
R0043:Sbf1 UTSW 15 89295561 missense probably benign 0.26
R0139:Sbf1 UTSW 15 89302498 missense probably damaging 1.00
R0528:Sbf1 UTSW 15 89288712 missense probably damaging 0.99
R0624:Sbf1 UTSW 15 89302329 missense possibly damaging 0.68
R0759:Sbf1 UTSW 15 89304716 missense probably damaging 1.00
R1555:Sbf1 UTSW 15 89305076 missense probably damaging 1.00
R1763:Sbf1 UTSW 15 89294425 missense probably damaging 1.00
R2025:Sbf1 UTSW 15 89302730 missense probably damaging 1.00
R2207:Sbf1 UTSW 15 89306693 missense possibly damaging 0.88
R2844:Sbf1 UTSW 15 89303218 critical splice donor site probably null
R2845:Sbf1 UTSW 15 89303218 critical splice donor site probably null
R3788:Sbf1 UTSW 15 89299528 nonsense probably null
R4108:Sbf1 UTSW 15 89288585 unclassified probably benign
R4403:Sbf1 UTSW 15 89293954 missense possibly damaging 0.94
R4605:Sbf1 UTSW 15 89303481 missense probably damaging 1.00
R4620:Sbf1 UTSW 15 89306926 missense probably damaging 0.99
R4666:Sbf1 UTSW 15 89295246 missense probably damaging 1.00
R4696:Sbf1 UTSW 15 89303112 nonsense probably null
R4697:Sbf1 UTSW 15 89315085 missense possibly damaging 0.71
R4747:Sbf1 UTSW 15 89302713 missense probably damaging 1.00
R5828:Sbf1 UTSW 15 89288634 missense probably damaging 1.00
R5841:Sbf1 UTSW 15 89308068 missense probably damaging 1.00
R6185:Sbf1 UTSW 15 89305611 missense probably damaging 1.00
R6237:Sbf1 UTSW 15 89293476 missense probably benign 0.29
R6490:Sbf1 UTSW 15 89304908 missense probably benign
R6933:Sbf1 UTSW 15 89300369 missense probably damaging 1.00
R7806:Sbf1 UTSW 15 89305420 missense possibly damaging 0.52
R7921:Sbf1 UTSW 15 89306223 missense probably damaging 0.96
R8005:Sbf1 UTSW 15 89294205 missense probably damaging 0.98
R8350:Sbf1 UTSW 15 89299509 missense probably damaging 0.99
R8450:Sbf1 UTSW 15 89299509 missense probably damaging 0.99
R8509:Sbf1 UTSW 15 89293457 missense probably damaging 1.00
R8753:Sbf1 UTSW 15 89295459 missense probably benign
R8788:Sbf1 UTSW 15 89301859 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATTCTTCATCAGGTTCCGG -3'
(R):5'- GGGAGCCTGTGAACTGAATAC -3'

Sequencing Primer
(F):5'- TTCTGGGGTGTAAAAGTCCAAC -3'
(R):5'- AGCCTGTGAACTGAATACTATGG -3'
Posted On2018-02-28