Incidental Mutation 'R6256:Dnase1'
ID 506142
Institutional Source Beutler Lab
Gene Symbol Dnase1
Ensembl Gene ENSMUSG00000005980
Gene Name deoxyribonuclease I
Synonyms Dnl1, DNaseI
MMRRC Submission 044373-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.465) question?
Stock # R6256 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 3855007-3857888 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 3855485 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Lysine at position 24 (R24K)
Ref Sequence ENSEMBL: ENSMUSP00000135442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006136] [ENSMUST00000006137] [ENSMUST00000120009] [ENSMUST00000137748] [ENSMUST00000157044] [ENSMUST00000177337] [ENSMUST00000175755]
AlphaFold P49183
Predicted Effect probably benign
Transcript: ENSMUST00000006136
AA Change: R24K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000006136
Gene: ENSMUSG00000005980
AA Change: R24K

DomainStartEndE-ValueType
DNaseIc 6 282 5.04e-220 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000006137
SMART Domains Protein: ENSMUSP00000006137
Gene: ENSMUSG00000005981

DomainStartEndE-ValueType
HATPase_c 110 263 3.68e-3 SMART
Pfam:HSP90 290 706 2.6e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120009
AA Change: R24K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113119
Gene: ENSMUSG00000005980
AA Change: R24K

DomainStartEndE-ValueType
DNaseIc 6 282 5.04e-220 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132466
Predicted Effect probably benign
Transcript: ENSMUST00000137748
AA Change: R24K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119934
Gene: ENSMUSG00000005980
AA Change: R24K

DomainStartEndE-ValueType
DNaseIc 6 225 7.51e-146 SMART
Predicted Effect unknown
Transcript: ENSMUST00000157044
AA Change: R24K
SMART Domains Protein: ENSMUSP00000120642
Gene: ENSMUSG00000005980
AA Change: R24K

DomainStartEndE-ValueType
DNaseIc 6 70 4.5e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177337
AA Change: R24K

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000135442
Gene: ENSMUSG00000005980
AA Change: R24K

DomainStartEndE-ValueType
DNaseIc 6 200 6.86e-67 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144792
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176642
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139334
Predicted Effect probably benign
Transcript: ENSMUST00000175755
SMART Domains Protein: ENSMUSP00000135060
Gene: ENSMUSG00000005980

DomainStartEndE-ValueType
SCOP:d2dnja_ 1 52 3e-9 SMART
Blast:DNaseIc 1 61 2e-31 BLAST
PDB:3W3D|B 1 61 5e-27 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149670
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNase family. This protein is stored in the zymogen granules of the nuclear envelope and functions by cleaving DNA in an endonucleolytic manner. At least six autosomal codominant alleles have been characterized, DNASE1*1 through DNASE1*6, and the sequence of DNASE1*2 represented in this record. Mutations in this gene have been associated with systemic lupus erythematosus (SLE), an autoimmune disease. A recombinant form of this protein is used to treat the one of the symptoms of cystic fibrosis by hydrolyzing the extracellular DNA in sputum and reducing its viscosity. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Some heterozygote and homozygote null mice have autoimmune symptoms similar to systemic lupus erythematosus. These include enlarged lymph nodes, circulating auto-antibodies, kidney inflammation and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A T 8: 73,205,272 (GRCm39) Q361L probably damaging Het
Abca7 A G 10: 79,838,456 (GRCm39) T577A probably damaging Het
Acad12 A T 5: 121,752,149 (GRCm39) V54E probably benign Het
Ago4 A G 4: 126,414,019 (GRCm39) Y91H probably damaging Het
Akr1b10 T C 6: 34,364,623 (GRCm39) V28A probably damaging Het
Ccdc33 T A 9: 58,009,201 (GRCm39) probably null Het
Ccdc7a T C 8: 129,662,074 (GRCm39) probably null Het
Ces1f A T 8: 93,992,422 (GRCm39) V343E probably damaging Het
Cftr T C 6: 18,274,660 (GRCm39) L896P probably damaging Het
Csmd3 G A 15: 47,533,125 (GRCm39) P2375S probably damaging Het
Dnajb14 C T 3: 137,614,124 (GRCm39) A345V probably damaging Het
Dnajb14 G C 3: 137,614,123 (GRCm39) A345P probably damaging Het
Dnmbp C T 19: 43,840,720 (GRCm39) V560M probably damaging Het
Dop1b T A 16: 93,604,102 (GRCm39) I1981N possibly damaging Het
Eif3a A C 19: 60,759,464 (GRCm39) S770A possibly damaging Het
Fbxl7 A T 15: 26,553,088 (GRCm39) C60S probably benign Het
Fras1 A T 5: 96,881,702 (GRCm39) D2478V possibly damaging Het
Hrnr A G 3: 93,229,918 (GRCm39) D52G probably damaging Het
Jmjd1c T A 10: 67,056,187 (GRCm39) L823M probably damaging Het
Kdm1a G T 4: 136,295,911 (GRCm39) C172* probably null Het
Kdm6b C T 11: 69,297,555 (GRCm39) E295K probably damaging Het
Mepe A T 5: 104,484,940 (GRCm39) M27L probably benign Het
Mogat2 A T 7: 98,869,102 (GRCm39) H305Q probably damaging Het
Mst1r T A 9: 107,794,465 (GRCm39) Y1215N probably damaging Het
Muc5ac A T 7: 141,343,532 (GRCm39) H48L possibly damaging Het
Myo7b T C 18: 32,116,748 (GRCm39) D953G probably damaging Het
Ocel1 T C 8: 71,824,472 (GRCm39) probably benign Het
Pcdhb6 A G 18: 37,468,978 (GRCm39) D633G probably damaging Het
Ppm1l A G 3: 69,405,230 (GRCm39) I176V probably benign Het
Sall3 C T 18: 81,013,076 (GRCm39) R1120H possibly damaging Het
Sbf1 G A 15: 89,185,070 (GRCm39) P1018S probably benign Het
Setbp1 T C 18: 78,900,472 (GRCm39) Y1065C probably damaging Het
Slc25a2 T C 18: 37,770,776 (GRCm39) probably null Het
Slc4a2 C A 5: 24,640,888 (GRCm39) T729K probably damaging Het
Sptlc2 T C 12: 87,402,305 (GRCm39) E207G probably damaging Het
Sult6b1 A T 17: 79,214,343 (GRCm39) F27I probably benign Het
Syf2 A T 4: 134,661,889 (GRCm39) K84N probably damaging Het
Tmem209 A T 6: 30,497,166 (GRCm39) N183K probably benign Het
Tmem232 G T 17: 65,785,397 (GRCm39) Q188K possibly damaging Het
Tomm70a A T 16: 56,973,055 (GRCm39) T598S probably benign Het
Ttll13 A G 7: 79,908,052 (GRCm39) T556A probably benign Het
Vmn2r120 A T 17: 57,831,700 (GRCm39) L363* probably null Het
Xpo6 G T 7: 125,707,791 (GRCm39) Q872K probably damaging Het
Xrra1 A C 7: 99,563,671 (GRCm39) S553R probably damaging Het
Zfy1 A T Y: 738,765 (GRCm39) V147E unknown Homo
Zfy2 T C Y: 2,116,267 (GRCm39) I258V probably benign Homo
Other mutations in Dnase1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00649:Dnase1 APN 16 3,856,888 (GRCm39) missense probably damaging 1.00
IGL00896:Dnase1 APN 16 3,857,076 (GRCm39) missense probably benign 0.00
IGL00983:Dnase1 APN 16 3,857,417 (GRCm39) missense possibly damaging 0.70
IGL02186:Dnase1 APN 16 3,856,896 (GRCm39) missense probably benign 0.18
IGL03373:Dnase1 APN 16 3,857,707 (GRCm39) missense probably damaging 1.00
R0009:Dnase1 UTSW 16 3,856,810 (GRCm39) missense probably damaging 1.00
R0009:Dnase1 UTSW 16 3,856,810 (GRCm39) missense probably damaging 1.00
R0355:Dnase1 UTSW 16 3,857,413 (GRCm39) missense probably damaging 1.00
R0467:Dnase1 UTSW 16 3,857,013 (GRCm39) missense probably damaging 1.00
R4964:Dnase1 UTSW 16 3,855,771 (GRCm39) intron probably benign
R4966:Dnase1 UTSW 16 3,855,771 (GRCm39) intron probably benign
R5014:Dnase1 UTSW 16 3,856,880 (GRCm39) nonsense probably null
R5621:Dnase1 UTSW 16 3,856,982 (GRCm39) missense probably benign 0.01
R5858:Dnase1 UTSW 16 3,857,513 (GRCm39) splice site probably benign
R6519:Dnase1 UTSW 16 3,856,453 (GRCm39) missense probably damaging 1.00
R7002:Dnase1 UTSW 16 3,857,410 (GRCm39) missense possibly damaging 0.76
R7977:Dnase1 UTSW 16 3,855,834 (GRCm39) missense probably damaging 1.00
R7987:Dnase1 UTSW 16 3,855,834 (GRCm39) missense probably damaging 1.00
R8050:Dnase1 UTSW 16 3,855,861 (GRCm39) missense probably damaging 1.00
R9781:Dnase1 UTSW 16 3,857,054 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCAGGTCTGTTCTGACTGC -3'
(R):5'- ATCCACCCAGCTATGGTAAGG -3'

Sequencing Primer
(F):5'- TGCAGCCGTCTCAGATTG -3'
(R):5'- CTATGGTAAGGCCTCAGGTTCAC -3'
Posted On 2018-02-28