Incidental Mutation 'R6256:Dnase1'
ID506142
Institutional Source Beutler Lab
Gene Symbol Dnase1
Ensembl Gene ENSMUSG00000005980
Gene Namedeoxyribonuclease I
SynonymsDNaseI, Dnl1
MMRRC Submission 044373-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.330) question?
Stock #R6256 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location4036942-4040024 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4037621 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 24 (R24K)
Ref Sequence ENSEMBL: ENSMUSP00000135442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006136] [ENSMUST00000006137] [ENSMUST00000120009] [ENSMUST00000137748] [ENSMUST00000157044] [ENSMUST00000177337] [ENSMUST00000175755]
Predicted Effect probably benign
Transcript: ENSMUST00000006136
AA Change: R24K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000006136
Gene: ENSMUSG00000005980
AA Change: R24K

DomainStartEndE-ValueType
DNaseIc 6 282 5.04e-220 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000006137
SMART Domains Protein: ENSMUSP00000006137
Gene: ENSMUSG00000005981

DomainStartEndE-ValueType
HATPase_c 110 263 3.68e-3 SMART
Pfam:HSP90 290 706 2.6e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120009
AA Change: R24K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113119
Gene: ENSMUSG00000005980
AA Change: R24K

DomainStartEndE-ValueType
DNaseIc 6 282 5.04e-220 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132466
Predicted Effect probably benign
Transcript: ENSMUST00000137748
AA Change: R24K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119934
Gene: ENSMUSG00000005980
AA Change: R24K

DomainStartEndE-ValueType
DNaseIc 6 225 7.51e-146 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144792
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150906
Predicted Effect unknown
Transcript: ENSMUST00000157044
AA Change: R24K
SMART Domains Protein: ENSMUSP00000120642
Gene: ENSMUSG00000005980
AA Change: R24K

DomainStartEndE-ValueType
DNaseIc 6 70 4.5e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177337
AA Change: R24K

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000135442
Gene: ENSMUSG00000005980
AA Change: R24K

DomainStartEndE-ValueType
DNaseIc 6 200 6.86e-67 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176642
Predicted Effect probably benign
Transcript: ENSMUST00000175755
SMART Domains Protein: ENSMUSP00000135060
Gene: ENSMUSG00000005980

DomainStartEndE-ValueType
SCOP:d2dnja_ 1 52 3e-9 SMART
Blast:DNaseIc 1 61 2e-31 BLAST
PDB:3W3D|B 1 61 5e-27 PDB
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNase family. This protein is stored in the zymogen granules of the nuclear envelope and functions by cleaving DNA in an endonucleolytic manner. At least six autosomal codominant alleles have been characterized, DNASE1*1 through DNASE1*6, and the sequence of DNASE1*2 represented in this record. Mutations in this gene have been associated with systemic lupus erythematosus (SLE), an autoimmune disease. A recombinant form of this protein is used to treat the one of the symptoms of cystic fibrosis by hydrolyzing the extracellular DNA in sputum and reducing its viscosity. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Some heterozygote and homozygote null mice have autoimmune symptoms similar to systemic lupus erythematosus. These include enlarged lymph nodes, circulating auto-antibodies, kidney inflammation and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A T 8: 72,451,428 Q361L probably damaging Het
Abca7 A G 10: 80,002,622 T577A probably damaging Het
Acad12 A T 5: 121,614,086 V54E probably benign Het
Ago4 A G 4: 126,520,226 Y91H probably damaging Het
Akr1b10 T C 6: 34,387,688 V28A probably damaging Het
Ccdc33 T A 9: 58,101,918 probably null Het
Ccdc7a T C 8: 128,935,593 probably null Het
Ces1f A T 8: 93,265,794 V343E probably damaging Het
Cftr T C 6: 18,274,661 L896P probably damaging Het
Csmd3 G A 15: 47,669,729 P2375S probably damaging Het
Dnajb14 G C 3: 137,908,362 A345P probably damaging Het
Dnajb14 C T 3: 137,908,363 A345V probably damaging Het
Dnmbp C T 19: 43,852,281 V560M probably damaging Het
Dopey2 T A 16: 93,807,214 I1981N possibly damaging Het
Eif3a A C 19: 60,771,026 S770A possibly damaging Het
Fbxl7 A T 15: 26,553,002 C60S probably benign Het
Fras1 A T 5: 96,733,843 D2478V possibly damaging Het
Hrnr A G 3: 93,322,611 D52G probably damaging Het
Jmjd1c T A 10: 67,220,408 L823M probably damaging Het
Kdm1a G T 4: 136,568,600 C172* probably null Het
Kdm6b C T 11: 69,406,729 E295K probably damaging Het
Mepe A T 5: 104,337,074 M27L probably benign Het
Mogat2 A T 7: 99,219,895 H305Q probably damaging Het
Mst1r T A 9: 107,917,266 Y1215N probably damaging Het
Muc5ac A T 7: 141,789,795 H48L possibly damaging Het
Myo7b T C 18: 31,983,695 D953G probably damaging Het
Ocel1 T C 8: 71,371,828 probably benign Het
Pcdhb6 A G 18: 37,335,925 D633G probably damaging Het
Ppm1l A G 3: 69,497,897 I176V probably benign Het
Sall3 C T 18: 80,969,861 R1120H possibly damaging Het
Sbf1 G A 15: 89,300,867 P1018S probably benign Het
Setbp1 T C 18: 78,857,257 Y1065C probably damaging Het
Slc25a2 T C 18: 37,637,723 probably null Het
Slc4a2 C A 5: 24,435,890 T729K probably damaging Het
Sptlc2 T C 12: 87,355,531 E207G probably damaging Het
Sult6b1 A T 17: 78,906,914 F27I probably benign Het
Syf2 A T 4: 134,934,578 K84N probably damaging Het
Tmem209 A T 6: 30,497,167 N183K probably benign Het
Tmem232 G T 17: 65,478,402 Q188K possibly damaging Het
Tomm70a A T 16: 57,152,692 T598S probably benign Het
Ttll13 A G 7: 80,258,304 T556A probably benign Het
Vmn2r120 A T 17: 57,524,700 L363* probably null Het
Xpo6 G T 7: 126,108,619 Q872K probably damaging Het
Xrra1 A C 7: 99,914,464 S553R probably damaging Het
Zfy1 A T Y: 738,765 V147E unknown Homo
Zfy2 T C Y: 2,116,267 I258V probably benign Homo
Other mutations in Dnase1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00649:Dnase1 APN 16 4039024 missense probably damaging 1.00
IGL00896:Dnase1 APN 16 4039212 missense probably benign 0.00
IGL00983:Dnase1 APN 16 4039553 missense possibly damaging 0.70
IGL02186:Dnase1 APN 16 4039032 missense probably benign 0.18
IGL03373:Dnase1 APN 16 4039843 missense probably damaging 1.00
R0009:Dnase1 UTSW 16 4038946 missense probably damaging 1.00
R0009:Dnase1 UTSW 16 4038946 missense probably damaging 1.00
R0355:Dnase1 UTSW 16 4039549 missense probably damaging 1.00
R0467:Dnase1 UTSW 16 4039149 missense probably damaging 1.00
R4964:Dnase1 UTSW 16 4037907 intron probably benign
R4966:Dnase1 UTSW 16 4037907 intron probably benign
R5014:Dnase1 UTSW 16 4039016 nonsense probably null
R5621:Dnase1 UTSW 16 4039118 missense probably benign 0.01
R5858:Dnase1 UTSW 16 4039649 splice site probably benign
R6519:Dnase1 UTSW 16 4038589 missense probably damaging 1.00
R7002:Dnase1 UTSW 16 4039546 missense possibly damaging 0.76
R7977:Dnase1 UTSW 16 4037970 missense probably damaging 1.00
R7987:Dnase1 UTSW 16 4037970 missense probably damaging 1.00
R8050:Dnase1 UTSW 16 4037997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGGTCTGTTCTGACTGC -3'
(R):5'- ATCCACCCAGCTATGGTAAGG -3'

Sequencing Primer
(F):5'- TGCAGCCGTCTCAGATTG -3'
(R):5'- CTATGGTAAGGCCTCAGGTTCAC -3'
Posted On2018-02-28