Incidental Mutation 'R6256:Tomm70a'
ID506143
Institutional Source Beutler Lab
Gene Symbol Tomm70a
Ensembl Gene ENSMUSG00000022752
Gene Nametranslocase of outer mitochondrial membrane 70A
SynonymsTomm70a, D16Wsu109e, D16Ium22e, Tom70, 2610044B22Rik, D16Ium22
MMRRC Submission 044373-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R6256 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location57121703-57156705 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57152692 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 598 (T598S)
Ref Sequence ENSEMBL: ENSMUSP00000129186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023432] [ENSMUST00000166897] [ENSMUST00000231423] [ENSMUST00000231733] [ENSMUST00000231934]
Predicted Effect probably benign
Transcript: ENSMUST00000023432
SMART Domains Protein: ENSMUSP00000023432
Gene: ENSMUSG00000022751

DomainStartEndE-ValueType
Pfam:CN_hydrolase 5 256 3.5e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166897
AA Change: T598S

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000129186
Gene: ENSMUSG00000022752
AA Change: T598S

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
low complexity region 45 61 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 98 108 N/A INTRINSIC
TPR 117 150 1.04e-7 SMART
TPR 156 189 1.97e-3 SMART
TPR 190 223 1.6e1 SMART
low complexity region 278 291 N/A INTRINSIC
TPR 332 365 1.17e1 SMART
TPR 370 403 3.5e0 SMART
TPR 404 437 3.32e-1 SMART
TPR 445 478 7.49e1 SMART
TPR 479 512 9.39e-1 SMART
TPR 513 547 9.48e1 SMART
TPR 548 581 4.03e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231423
Predicted Effect probably benign
Transcript: ENSMUST00000231733
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231901
Predicted Effect probably benign
Transcript: ENSMUST00000231934
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an import receptor of the outer mitochondrial membrane that is part of the translocase of the outer membrane complex. This protein is involved in the import of mitochondrial precursor proteins. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A T 8: 72,451,428 Q361L probably damaging Het
Abca7 A G 10: 80,002,622 T577A probably damaging Het
Acad12 A T 5: 121,614,086 V54E probably benign Het
Ago4 A G 4: 126,520,226 Y91H probably damaging Het
Akr1b10 T C 6: 34,387,688 V28A probably damaging Het
Ccdc33 T A 9: 58,101,918 probably null Het
Ccdc7a T C 8: 128,935,593 probably null Het
Ces1f A T 8: 93,265,794 V343E probably damaging Het
Cftr T C 6: 18,274,661 L896P probably damaging Het
Csmd3 G A 15: 47,669,729 P2375S probably damaging Het
Dnajb14 G C 3: 137,908,362 A345P probably damaging Het
Dnajb14 C T 3: 137,908,363 A345V probably damaging Het
Dnase1 G A 16: 4,037,621 R24K probably benign Het
Dnmbp C T 19: 43,852,281 V560M probably damaging Het
Dopey2 T A 16: 93,807,214 I1981N possibly damaging Het
Eif3a A C 19: 60,771,026 S770A possibly damaging Het
Fbxl7 A T 15: 26,553,002 C60S probably benign Het
Fras1 A T 5: 96,733,843 D2478V possibly damaging Het
Hrnr A G 3: 93,322,611 D52G probably damaging Het
Jmjd1c T A 10: 67,220,408 L823M probably damaging Het
Kdm1a G T 4: 136,568,600 C172* probably null Het
Kdm6b C T 11: 69,406,729 E295K probably damaging Het
Mepe A T 5: 104,337,074 M27L probably benign Het
Mogat2 A T 7: 99,219,895 H305Q probably damaging Het
Mst1r T A 9: 107,917,266 Y1215N probably damaging Het
Muc5ac A T 7: 141,789,795 H48L possibly damaging Het
Myo7b T C 18: 31,983,695 D953G probably damaging Het
Ocel1 T C 8: 71,371,828 probably benign Het
Pcdhb6 A G 18: 37,335,925 D633G probably damaging Het
Ppm1l A G 3: 69,497,897 I176V probably benign Het
Sall3 C T 18: 80,969,861 R1120H possibly damaging Het
Sbf1 G A 15: 89,300,867 P1018S probably benign Het
Setbp1 T C 18: 78,857,257 Y1065C probably damaging Het
Slc25a2 T C 18: 37,637,723 probably null Het
Slc4a2 C A 5: 24,435,890 T729K probably damaging Het
Sptlc2 T C 12: 87,355,531 E207G probably damaging Het
Sult6b1 A T 17: 78,906,914 F27I probably benign Het
Syf2 A T 4: 134,934,578 K84N probably damaging Het
Tmem209 A T 6: 30,497,167 N183K probably benign Het
Tmem232 G T 17: 65,478,402 Q188K possibly damaging Het
Ttll13 A G 7: 80,258,304 T556A probably benign Het
Vmn2r120 A T 17: 57,524,700 L363* probably null Het
Xpo6 G T 7: 126,108,619 Q872K probably damaging Het
Xrra1 A C 7: 99,914,464 S553R probably damaging Het
Zfy1 A T Y: 738,765 V147E unknown Homo
Zfy2 T C Y: 2,116,267 I258V probably benign Homo
Other mutations in Tomm70a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00849:Tomm70a APN 16 57149810 splice site probably benign
IGL01064:Tomm70a APN 16 57152612 missense probably damaging 0.99
IGL01597:Tomm70a APN 16 57133188 missense probably benign 0.00
IGL02248:Tomm70a APN 16 57138102 missense probably benign 0.33
IGL02560:Tomm70a APN 16 57149849 missense probably benign 0.33
IGL03328:Tomm70a APN 16 57144787 missense probably damaging 0.99
IGL03335:Tomm70a APN 16 57149926 missense probably damaging 1.00
R0164:Tomm70a UTSW 16 57147821 missense probably damaging 0.96
R0164:Tomm70a UTSW 16 57147821 missense probably damaging 0.96
R0196:Tomm70a UTSW 16 57146100 missense probably benign 0.03
R0417:Tomm70a UTSW 16 57149903 missense probably benign 0.28
R0763:Tomm70a UTSW 16 57122172 missense probably benign 0.30
R1099:Tomm70a UTSW 16 57142817 missense probably damaging 1.00
R1680:Tomm70a UTSW 16 57121961 missense unknown
R2081:Tomm70a UTSW 16 57140758 missense probably damaging 0.99
R2127:Tomm70a UTSW 16 57121871 missense unknown
R3033:Tomm70a UTSW 16 57122025 missense probably damaging 1.00
R4287:Tomm70a UTSW 16 57140622 missense probably damaging 1.00
R5029:Tomm70a UTSW 16 57122151 missense probably benign
R5210:Tomm70a UTSW 16 57133251 critical splice donor site probably null
R5214:Tomm70a UTSW 16 57121937 missense unknown
R5586:Tomm70a UTSW 16 57122130 missense probably damaging 1.00
R5744:Tomm70a UTSW 16 57121839 start gained probably benign
R5872:Tomm70a UTSW 16 57144742 missense probably benign 0.06
R6699:Tomm70a UTSW 16 57142802 missense probably benign 0.02
R6902:Tomm70a UTSW 16 57138081 missense probably damaging 0.96
R7106:Tomm70a UTSW 16 57140758 missense probably damaging 0.99
R7378:Tomm70a UTSW 16 57146044 nonsense probably null
R7817:Tomm70a UTSW 16 57144773 missense probably damaging 1.00
R8002:Tomm70a UTSW 16 57136734 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAAGGCTTCATGCAGCACAG -3'
(R):5'- TGCAAACTTCCTTCAACAGC -3'

Sequencing Primer
(F):5'- GGCTTCATGCAGCACAGTTAAAC -3'
(R):5'- CACCTAAACATGAAACAGATGTAATG -3'
Posted On2018-02-28