Mutagenetix > Incidental Mutation

Incidental Mutation 'R6256:Dopey2'

506144

Institutional Source

Beutler Lab

Gene Symbol

Dopey2

Ensembl Gene

ENSMUSG00000022946

Gene Name

dopey family member 2

Synonyms

0610038M01Rik, 2610510B01Rik

MMRRC Submission

044373-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6256 (G1)

Quality Score

222.009

Status

Validated

Chromosome

Chromosomal Location

93711904-93810590 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 93807214 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 1981 (I1981N)

Ref Sequence

ENSEMBL: ENSMUSP00000154771 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045004] [ENSMUST00000227156]

AlphaFold

Q3UHQ6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000045004
AA Change: I2098N

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000044437
Gene: ENSMUSG00000022946
AA Change: I2098N

Domain	Start	End	E-Value	Type
Pfam:Dopey_N	11	308	3.9e-104	PFAM
low complexity region	651	666	N/A	INTRINSIC
low complexity region	709	719	N/A	INTRINSIC
low complexity region	747	759	N/A	INTRINSIC
low complexity region	1186	1199	N/A	INTRINSIC
low complexity region	1436	1451	N/A	INTRINSIC
low complexity region	1893	1908	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000226215

Predicted Effect

possibly damaging
Transcript: ENSMUST00000227156
AA Change: I1981N

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227278

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228423

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231503

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231882

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.5%

Validation Efficiency

99% (74/75)

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030K09Rik	A	T	8: 72,451,428	Q361L	probably damaging	Het
Abca7	A	G	10: 80,002,622	T577A	probably damaging	Het
Acad12	A	T	5: 121,614,086	V54E	probably benign	Het
Ago4	A	G	4: 126,520,226	Y91H	probably damaging	Het
Akr1b10	T	C	6: 34,387,688	V28A	probably damaging	Het
Ccdc33	T	A	9: 58,101,918		probably null	Het
Ccdc7a	T	C	8: 128,935,593		probably null	Het
Ces1f	A	T	8: 93,265,794	V343E	probably damaging	Het
Cftr	T	C	6: 18,274,661	L896P	probably damaging	Het
Csmd3	G	A	15: 47,669,729	P2375S	probably damaging	Het
Dnajb14	G	C	3: 137,908,362	A345P	probably damaging	Het
Dnajb14	C	T	3: 137,908,363	A345V	probably damaging	Het
Dnase1	G	A	16: 4,037,621	R24K	probably benign	Het
Dnmbp	C	T	19: 43,852,281	V560M	probably damaging	Het
Eif3a	A	C	19: 60,771,026	S770A	possibly damaging	Het
Fbxl7	A	T	15: 26,553,002	C60S	probably benign	Het
Fras1	A	T	5: 96,733,843	D2478V	possibly damaging	Het
Hrnr	A	G	3: 93,322,611	D52G	probably damaging	Het
Jmjd1c	T	A	10: 67,220,408	L823M	probably damaging	Het
Kdm1a	G	T	4: 136,568,600	C172*	probably null	Het
Kdm6b	C	T	11: 69,406,729	E295K	probably damaging	Het
Mepe	A	T	5: 104,337,074	M27L	probably benign	Het
Mogat2	A	T	7: 99,219,895	H305Q	probably damaging	Het
Mst1r	T	A	9: 107,917,266	Y1215N	probably damaging	Het
Muc5ac	A	T	7: 141,789,795	H48L	possibly damaging	Het
Myo7b	T	C	18: 31,983,695	D953G	probably damaging	Het
Ocel1	T	C	8: 71,371,828		probably benign	Het
Pcdhb6	A	G	18: 37,335,925	D633G	probably damaging	Het
Ppm1l	A	G	3: 69,497,897	I176V	probably benign	Het
Sall3	C	T	18: 80,969,861	R1120H	possibly damaging	Het
Sbf1	G	A	15: 89,300,867	P1018S	probably benign	Het
Setbp1	T	C	18: 78,857,257	Y1065C	probably damaging	Het
Slc25a2	T	C	18: 37,637,723		probably null	Het
Slc4a2	C	A	5: 24,435,890	T729K	probably damaging	Het
Sptlc2	T	C	12: 87,355,531	E207G	probably damaging	Het
Sult6b1	A	T	17: 78,906,914	F27I	probably benign	Het
Syf2	A	T	4: 134,934,578	K84N	probably damaging	Het
Tmem209	A	T	6: 30,497,167	N183K	probably benign	Het
Tmem232	G	T	17: 65,478,402	Q188K	possibly damaging	Het
Tomm70a	A	T	16: 57,152,692	T598S	probably benign	Het
Ttll13	A	G	7: 80,258,304	T556A	probably benign	Het
Vmn2r120	A	T	17: 57,524,700	L363*	probably null	Het
Xpo6	G	T	7: 126,108,619	Q872K	probably damaging	Het
Xrra1	A	C	7: 99,914,464	S553R	probably damaging	Het
Zfy1	A	T	Y: 738,765	V147E	unknown	Homo
Zfy2	T	C	Y: 2,116,267	I258V	probably benign	Homo

Other mutations in Dopey2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00476:Dopey2	APN	16	93800026	unclassified	probably benign
IGL00492:Dopey2	APN	16	93780782	missense	probably benign	0.00
IGL00753:Dopey2	APN	16	93769624	missense	probably benign
IGL00832:Dopey2	APN	16	93763401	missense	probably benign	0.01
IGL00939:Dopey2	APN	16	93774083	missense	possibly damaging	0.83
IGL01019:Dopey2	APN	16	93810229	missense	probably benign	0.32
IGL01288:Dopey2	APN	16	93739293	missense	possibly damaging	0.78
IGL01505:Dopey2	APN	16	93757116	missense	possibly damaging	0.87
IGL01535:Dopey2	APN	16	93769958	nonsense	probably null
IGL01696:Dopey2	APN	16	93770240	missense	probably benign	0.00
IGL02077:Dopey2	APN	16	93780760	missense	probably damaging	0.96
IGL02163:Dopey2	APN	16	93762427	missense	possibly damaging	0.48
IGL02234:Dopey2	APN	16	93752151	missense	probably benign
IGL02302:Dopey2	APN	16	93810117	missense	probably benign	0.08
IGL02485:Dopey2	APN	16	93770822	missense	probably damaging	1.00
IGL02563:Dopey2	APN	16	93777405	missense	probably damaging	0.99
IGL02733:Dopey2	APN	16	93739191	missense	possibly damaging	0.80
IGL02792:Dopey2	APN	16	93801572	missense	possibly damaging	0.75
IGL02941:Dopey2	APN	16	93755473	missense	probably benign	0.09
IGL03143:Dopey2	APN	16	93759655	missense	probably benign
PIT4519001:Dopey2	UTSW	16	93762054	missense	probably benign
R0320:Dopey2	UTSW	16	93810147	missense	probably benign	0.02
R0499:Dopey2	UTSW	16	93770437	missense	probably benign	0.00
R0501:Dopey2	UTSW	16	93752862	missense	probably benign	0.00
R0534:Dopey2	UTSW	16	93762505	missense	probably benign	0.04
R0583:Dopey2	UTSW	16	93755486	missense	probably benign	0.30
R0626:Dopey2	UTSW	16	93763956	missense	probably damaging	1.00
R0724:Dopey2	UTSW	16	93762325	missense	probably benign	0.01
R0907:Dopey2	UTSW	16	93801593	missense	probably damaging	1.00
R1263:Dopey2	UTSW	16	93777386	missense	probably benign
R1378:Dopey2	UTSW	16	93770392	missense	probably benign
R1572:Dopey2	UTSW	16	93770153	missense	probably damaging	1.00
R1604:Dopey2	UTSW	16	93762570	missense	probably benign
R1642:Dopey2	UTSW	16	93762315	missense	probably benign	0.00
R1668:Dopey2	UTSW	16	93765516	missense	probably damaging	1.00
R1669:Dopey2	UTSW	16	93769660	missense	probably damaging	1.00
R1702:Dopey2	UTSW	16	93747621	missense	possibly damaging	0.47
R1711:Dopey2	UTSW	16	93799926	missense	probably damaging	1.00
R1917:Dopey2	UTSW	16	93716262	missense	probably damaging	1.00
R1968:Dopey2	UTSW	16	93782419	missense	probably damaging	1.00
R1988:Dopey2	UTSW	16	93766173	missense	probably damaging	1.00
R2029:Dopey2	UTSW	16	93769435	missense	probably benign	0.36
R2139:Dopey2	UTSW	16	93771007	missense	possibly damaging	0.78
R2355:Dopey2	UTSW	16	93770677	missense	probably damaging	1.00
R3609:Dopey2	UTSW	16	93739332	missense	probably damaging	1.00
R3792:Dopey2	UTSW	16	93771846	missense	possibly damaging	0.54
R4364:Dopey2	UTSW	16	93770924	missense	probably benign	0.00
R4380:Dopey2	UTSW	16	93716232	missense	possibly damaging	0.53
R4455:Dopey2	UTSW	16	93766215	missense	probably damaging	1.00
R4779:Dopey2	UTSW	16	93757081	missense	probably damaging	1.00
R4820:Dopey2	UTSW	16	93793090	missense	probably benign	0.00
R4834:Dopey2	UTSW	16	93740004	start codon destroyed	probably null	0.70
R4866:Dopey2	UTSW	16	93763430	critical splice donor site	probably null
R4882:Dopey2	UTSW	16	93752914	missense	possibly damaging	0.95
R4900:Dopey2	UTSW	16	93763430	critical splice donor site	probably null
R5153:Dopey2	UTSW	16	93774003	missense	probably damaging	0.98
R5176:Dopey2	UTSW	16	93740043	missense	probably damaging	1.00
R5206:Dopey2	UTSW	16	93801584	missense	probably damaging	1.00
R5320:Dopey2	UTSW	16	93739986	missense	probably damaging	1.00
R5361:Dopey2	UTSW	16	93770504	missense	probably damaging	1.00
R5380:Dopey2	UTSW	16	93763410	missense	probably damaging	0.96
R5476:Dopey2	UTSW	16	93773913	splice site	probably null
R5502:Dopey2	UTSW	16	93793226	missense	probably benign	0.00
R5543:Dopey2	UTSW	16	93798920	missense	probably damaging	0.98
R5557:Dopey2	UTSW	16	93763931	missense	probably damaging	0.96
R5901:Dopey2	UTSW	16	93769751	missense	possibly damaging	0.88
R5907:Dopey2	UTSW	16	93801581	missense	probably damaging	1.00
R6174:Dopey2	UTSW	16	93766222	missense	probably damaging	1.00
R6383:Dopey2	UTSW	16	93782248	missense	possibly damaging	0.76
R6525:Dopey2	UTSW	16	93809416	missense	probably damaging	1.00
R6554:Dopey2	UTSW	16	93760458	missense	probably benign	0.22
R6823:Dopey2	UTSW	16	93755485	missense	possibly damaging	0.75
R7036:Dopey2	UTSW	16	93777490	missense	probably benign	0.01
R7058:Dopey2	UTSW	16	93776990	missense	probably benign	0.00
R7061:Dopey2	UTSW	16	93762063	missense	probably benign	0.00
R7209:Dopey2	UTSW	16	93769845	missense	probably benign
R7214:Dopey2	UTSW	16	93810135	missense	possibly damaging	0.69
R7232:Dopey2	UTSW	16	93760485	critical splice donor site	probably null
R7255:Dopey2	UTSW	16	93770146	missense	probably damaging	1.00
R7335:Dopey2	UTSW	16	93747508	missense	probably benign	0.04
R7535:Dopey2	UTSW	16	93806361	missense	probably damaging	1.00
R7700:Dopey2	UTSW	16	93798761	splice site	probably null
R7763:Dopey2	UTSW	16	93755514	missense	probably benign	0.00
R7814:Dopey2	UTSW	16	93799971	missense	probably damaging	1.00
R7839:Dopey2	UTSW	16	93763941	missense	probably damaging	1.00
R7862:Dopey2	UTSW	16	93749963	missense	probably damaging	1.00
R7894:Dopey2	UTSW	16	93810204	missense	probably benign	0.01
R7952:Dopey2	UTSW	16	93749960	missense	possibly damaging	0.93
R7956:Dopey2	UTSW	16	93771028	critical splice donor site	probably null
R8033:Dopey2	UTSW	16	93769483	missense	probably benign
R8061:Dopey2	UTSW	16	93749996	missense	probably damaging	1.00
R8067:Dopey2	UTSW	16	93765448	nonsense	probably null
R8146:Dopey2	UTSW	16	93749939	missense	possibly damaging	0.95
R8184:Dopey2	UTSW	16	93776993	missense	probably benign	0.13
R8221:Dopey2	UTSW	16	93749959	missense	probably benign	0.01
R8263:Dopey2	UTSW	16	93762195	missense	possibly damaging	0.87
R8329:Dopey2	UTSW	16	93771787	missense	probably damaging	1.00
R8555:Dopey2	UTSW	16	93771810	missense	probably damaging	1.00
R8683:Dopey2	UTSW	16	93771811	missense	probably damaging	0.98
R8683:Dopey2	UTSW	16	93773921	missense	probably benign
R8716:Dopey2	UTSW	16	93780785	nonsense	probably null
R8807:Dopey2	UTSW	16	93762085	missense	probably benign	0.03
R8840:Dopey2	UTSW	16	93810117	missense	probably benign	0.08
R8851:Dopey2	UTSW	16	93762510	missense	probably benign	0.39
R8884:Dopey2	UTSW	16	93759662	missense	probably benign
R8976:Dopey2	UTSW	16	93762081	missense	probably benign	0.01
R9219:Dopey2	UTSW	16	93770296	missense	probably damaging	1.00
R9238:Dopey2	UTSW	16	93749130	missense	probably benign	0.14
R9284:Dopey2	UTSW	16	93760308	missense	probably damaging	1.00
R9289:Dopey2	UTSW	16	93771793	missense	probably damaging	1.00
R9298:Dopey2	UTSW	16	93800199	missense	probably damaging	0.96
R9338:Dopey2	UTSW	16	93803560	missense	probably damaging	1.00
R9346:Dopey2	UTSW	16	93780814	critical splice donor site	probably null
R9444:Dopey2	UTSW	16	93810239	missense	probably benign	0.00
R9500:Dopey2	UTSW	16	93810283	missense	probably benign
R9601:Dopey2	UTSW	16	93747643	missense	possibly damaging	0.87
R9793:Dopey2	UTSW	16	93801615	missense	probably benign	0.30
Z1088:Dopey2	UTSW	16	93763326	missense	probably benign	0.00
Z1176:Dopey2	UTSW	16	93769581	missense	probably benign	0.00
Z1176:Dopey2	UTSW	16	93803546	missense	probably damaging	1.00
Z1176:Dopey2	UTSW	16	93807868	missense	possibly damaging	0.82
Z1177:Dopey2	UTSW	16	93763895	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCAATCCCGGAGCTGCTTG -3'
(R):5'- ACATCTTAACACTGGCTGGTC -3'

Sequencing Primer
(F):5'- TGCGTAGGCTCCAGTCTC -3'
(R):5'- TAACACTGGCTGGTCCCACC -3'

Posted On

2018-02-28