Incidental Mutation 'R6256:Vmn2r120'
ID506145
Institutional Source Beutler Lab
Gene Symbol Vmn2r120
Ensembl Gene ENSMUSG00000090655
Gene Namevomeronasal 2, receptor 120
SynonymsEG224916
MMRRC Submission 044373-MU
Accession Numbers

Genbank: NM_001104591; MGI: 3644483

Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R6256 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location57508783-57545314 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 57524700 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 363 (L363*)
Ref Sequence ENSEMBL: ENSMUSP00000129296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165781]
Predicted Effect probably null
Transcript: ENSMUST00000165781
AA Change: L363*
SMART Domains Protein: ENSMUSP00000129296
Gene: ENSMUSG00000090655
AA Change: L363*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 80 474 5.9e-42 PFAM
Pfam:NCD3G 517 570 7.5e-22 PFAM
Pfam:7tm_3 598 836 1.3e-54 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A T 8: 72,451,428 Q361L probably damaging Het
Abca7 A G 10: 80,002,622 T577A probably damaging Het
Acad12 A T 5: 121,614,086 V54E probably benign Het
Ago4 A G 4: 126,520,226 Y91H probably damaging Het
Akr1b10 T C 6: 34,387,688 V28A probably damaging Het
Ccdc33 T A 9: 58,101,918 probably null Het
Ccdc7a T C 8: 128,935,593 probably null Het
Ces1f A T 8: 93,265,794 V343E probably damaging Het
Cftr T C 6: 18,274,661 L896P probably damaging Het
Csmd3 G A 15: 47,669,729 P2375S probably damaging Het
Dnajb14 G C 3: 137,908,362 A345P probably damaging Het
Dnajb14 C T 3: 137,908,363 A345V probably damaging Het
Dnase1 G A 16: 4,037,621 R24K probably benign Het
Dnmbp C T 19: 43,852,281 V560M probably damaging Het
Dopey2 T A 16: 93,807,214 I1981N possibly damaging Het
Eif3a A C 19: 60,771,026 S770A possibly damaging Het
Fbxl7 A T 15: 26,553,002 C60S probably benign Het
Fras1 A T 5: 96,733,843 D2478V possibly damaging Het
Hrnr A G 3: 93,322,611 D52G probably damaging Het
Jmjd1c T A 10: 67,220,408 L823M probably damaging Het
Kdm1a G T 4: 136,568,600 C172* probably null Het
Kdm6b C T 11: 69,406,729 E295K probably damaging Het
Mepe A T 5: 104,337,074 M27L probably benign Het
Mogat2 A T 7: 99,219,895 H305Q probably damaging Het
Mst1r T A 9: 107,917,266 Y1215N probably damaging Het
Muc5ac A T 7: 141,789,795 H48L possibly damaging Het
Myo7b T C 18: 31,983,695 D953G probably damaging Het
Ocel1 T C 8: 71,371,828 probably benign Het
Pcdhb6 A G 18: 37,335,925 D633G probably damaging Het
Ppm1l A G 3: 69,497,897 I176V probably benign Het
Sall3 C T 18: 80,969,861 R1120H possibly damaging Het
Sbf1 G A 15: 89,300,867 P1018S probably benign Het
Setbp1 T C 18: 78,857,257 Y1065C probably damaging Het
Slc25a2 T C 18: 37,637,723 probably null Het
Slc4a2 C A 5: 24,435,890 T729K probably damaging Het
Sptlc2 T C 12: 87,355,531 E207G probably damaging Het
Sult6b1 A T 17: 78,906,914 F27I probably benign Het
Syf2 A T 4: 134,934,578 K84N probably damaging Het
Tmem209 A T 6: 30,497,167 N183K probably benign Het
Tmem232 G T 17: 65,478,402 Q188K possibly damaging Het
Tomm70a A T 16: 57,152,692 T598S probably benign Het
Ttll13 A G 7: 80,258,304 T556A probably benign Het
Xpo6 G T 7: 126,108,619 Q872K probably damaging Het
Xrra1 A C 7: 99,914,464 S553R probably damaging Het
Zfy1 A T Y: 738,765 V147E unknown Homo
Zfy2 T C Y: 2,116,267 I258V probably benign Homo
Other mutations in Vmn2r120
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Vmn2r120 APN 17 57525732 missense possibly damaging 0.86
IGL01346:Vmn2r120 APN 17 57545232 missense probably benign 0.11
IGL01996:Vmn2r120 APN 17 57525222 missense possibly damaging 0.92
IGL02503:Vmn2r120 APN 17 57509385 missense probably benign 0.40
IGL02582:Vmn2r120 APN 17 57524724 missense probably damaging 0.99
IGL02747:Vmn2r120 APN 17 57524719 missense probably benign 0.19
IGL02896:Vmn2r120 APN 17 57509008 missense probably damaging 1.00
IGL03139:Vmn2r120 APN 17 57524742 missense probably benign 0.39
IGL03342:Vmn2r120 APN 17 57509372 missense probably benign 0.03
A4554:Vmn2r120 UTSW 17 57525715 missense probably benign 0.01
R0207:Vmn2r120 UTSW 17 57525052 missense probably benign 0.17
R0472:Vmn2r120 UTSW 17 57524518 missense probably benign 0.03
R0517:Vmn2r120 UTSW 17 57508949 missense probably damaging 1.00
R1109:Vmn2r120 UTSW 17 57525829 missense probably benign 0.09
R1316:Vmn2r120 UTSW 17 57525939 missense probably benign 0.28
R1543:Vmn2r120 UTSW 17 57522374 missense probably benign 0.09
R1795:Vmn2r120 UTSW 17 57525038 missense probably benign 0.35
R1850:Vmn2r120 UTSW 17 57525826 missense probably benign 0.19
R1920:Vmn2r120 UTSW 17 57524839 missense probably benign 0.01
R1921:Vmn2r120 UTSW 17 57524839 missense probably benign 0.01
R1922:Vmn2r120 UTSW 17 57524839 missense probably benign 0.01
R2063:Vmn2r120 UTSW 17 57524553 missense possibly damaging 0.88
R2064:Vmn2r120 UTSW 17 57524553 missense possibly damaging 0.88
R2065:Vmn2r120 UTSW 17 57524553 missense possibly damaging 0.88
R2067:Vmn2r120 UTSW 17 57524553 missense possibly damaging 0.88
R2286:Vmn2r120 UTSW 17 57508958 missense probably damaging 1.00
R2291:Vmn2r120 UTSW 17 57509479 missense probably damaging 1.00
R3416:Vmn2r120 UTSW 17 57509241 missense possibly damaging 0.89
R3874:Vmn2r120 UTSW 17 57524954 missense probably benign 0.40
R4023:Vmn2r120 UTSW 17 57536718 missense possibly damaging 0.92
R4024:Vmn2r120 UTSW 17 57536718 missense possibly damaging 0.92
R4348:Vmn2r120 UTSW 17 57522466 missense possibly damaging 0.47
R4409:Vmn2r120 UTSW 17 57509477 missense probably damaging 1.00
R4610:Vmn2r120 UTSW 17 57509120 missense probably damaging 1.00
R4771:Vmn2r120 UTSW 17 57524887 missense probably damaging 1.00
R4786:Vmn2r120 UTSW 17 57522048 missense probably benign 0.14
R4927:Vmn2r120 UTSW 17 57509125 missense probably damaging 1.00
R5285:Vmn2r120 UTSW 17 57536703 missense probably damaging 1.00
R5566:Vmn2r120 UTSW 17 57545290 missense possibly damaging 0.95
R5578:Vmn2r120 UTSW 17 57522514 missense probably benign 0.01
R5643:Vmn2r120 UTSW 17 57524977 missense probably benign 0.01
R5644:Vmn2r120 UTSW 17 57524977 missense probably benign 0.01
R5781:Vmn2r120 UTSW 17 57524938 missense probably benign 0.00
R6084:Vmn2r120 UTSW 17 57525721 missense probably benign 0.15
R6120:Vmn2r120 UTSW 17 57525973 missense probably benign 0.02
R6160:Vmn2r120 UTSW 17 57509418 missense probably benign 0.03
R6248:Vmn2r120 UTSW 17 57545287 missense probably benign 0.03
R6730:Vmn2r120 UTSW 17 57525012 missense probably benign 0.03
R6821:Vmn2r120 UTSW 17 57536659 missense probably benign 0.00
R6868:Vmn2r120 UTSW 17 57545218 missense probably benign 0.00
R6880:Vmn2r120 UTSW 17 57509187 missense probably damaging 1.00
R6986:Vmn2r120 UTSW 17 57509340 missense probably damaging 1.00
R7276:Vmn2r120 UTSW 17 57524881 missense probably benign 0.11
R7373:Vmn2r120 UTSW 17 57509406 missense probably benign 0.35
R7653:Vmn2r120 UTSW 17 57509258 missense possibly damaging 0.93
R7667:Vmn2r120 UTSW 17 57536657 missense probably benign 0.04
R7775:Vmn2r120 UTSW 17 57525942 missense probably damaging 1.00
R7778:Vmn2r120 UTSW 17 57525942 missense probably damaging 1.00
R7797:Vmn2r120 UTSW 17 57508874 missense probably damaging 1.00
R7824:Vmn2r120 UTSW 17 57525942 missense probably damaging 1.00
R7902:Vmn2r120 UTSW 17 57509244 missense possibly damaging 0.87
R7922:Vmn2r120 UTSW 17 57524683 missense probably damaging 0.99
R8508:Vmn2r120 UTSW 17 57525843 missense probably benign 0.03
R8847:Vmn2r120 UTSW 17 57509217 missense probably benign 0.01
R8882:Vmn2r120 UTSW 17 57545229 missense probably benign 0.01
RF005:Vmn2r120 UTSW 17 57521991 missense possibly damaging 0.65
Z1177:Vmn2r120 UTSW 17 57509245 missense probably benign 0.00
Z1188:Vmn2r120 UTSW 17 57522436 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTGCATGTTCTTGGAGCATTTC -3'
(R):5'- AGCATCAGGACAAGTAGACCCG -3'

Sequencing Primer
(F):5'- TCATGGAGGCTGTGGGCAAC -3'
(R):5'- GTCACAACCTCACAGTGGGATATTG -3'
Posted On2018-02-28