Incidental Mutation 'R6256:Tmem232'
ID 506146
Institutional Source Beutler Lab
Gene Symbol Tmem232
Ensembl Gene ENSMUSG00000045036
Gene Name transmembrane protein 232
Synonyms LOC381107, E130009J12Rik
MMRRC Submission 044373-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R6256 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 65562994-65847777 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 65785397 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 188 (Q188K)
Ref Sequence ENSEMBL: ENSMUSP00000083927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062161] [ENSMUST00000086722]
AlphaFold Q5K6N0
Predicted Effect possibly damaging
Transcript: ENSMUST00000062161
AA Change: Q188K

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000055652
Gene: ENSMUSG00000045036
AA Change: Q188K

DomainStartEndE-ValueType
Pfam:TMEM232 40 488 5.3e-235 PFAM
coiled coil region 598 634 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000086722
AA Change: Q188K

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000083927
Gene: ENSMUSG00000045036
AA Change: Q188K

DomainStartEndE-ValueType
low complexity region 61 67 N/A INTRINSIC
coiled coil region 598 634 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A T 8: 73,205,272 (GRCm39) Q361L probably damaging Het
Abca7 A G 10: 79,838,456 (GRCm39) T577A probably damaging Het
Acad12 A T 5: 121,752,149 (GRCm39) V54E probably benign Het
Ago4 A G 4: 126,414,019 (GRCm39) Y91H probably damaging Het
Akr1b10 T C 6: 34,364,623 (GRCm39) V28A probably damaging Het
Ccdc33 T A 9: 58,009,201 (GRCm39) probably null Het
Ccdc7a T C 8: 129,662,074 (GRCm39) probably null Het
Ces1f A T 8: 93,992,422 (GRCm39) V343E probably damaging Het
Cftr T C 6: 18,274,660 (GRCm39) L896P probably damaging Het
Csmd3 G A 15: 47,533,125 (GRCm39) P2375S probably damaging Het
Dnajb14 C T 3: 137,614,124 (GRCm39) A345V probably damaging Het
Dnajb14 G C 3: 137,614,123 (GRCm39) A345P probably damaging Het
Dnase1 G A 16: 3,855,485 (GRCm39) R24K probably benign Het
Dnmbp C T 19: 43,840,720 (GRCm39) V560M probably damaging Het
Dop1b T A 16: 93,604,102 (GRCm39) I1981N possibly damaging Het
Eif3a A C 19: 60,759,464 (GRCm39) S770A possibly damaging Het
Fbxl7 A T 15: 26,553,088 (GRCm39) C60S probably benign Het
Fras1 A T 5: 96,881,702 (GRCm39) D2478V possibly damaging Het
Hrnr A G 3: 93,229,918 (GRCm39) D52G probably damaging Het
Jmjd1c T A 10: 67,056,187 (GRCm39) L823M probably damaging Het
Kdm1a G T 4: 136,295,911 (GRCm39) C172* probably null Het
Kdm6b C T 11: 69,297,555 (GRCm39) E295K probably damaging Het
Mepe A T 5: 104,484,940 (GRCm39) M27L probably benign Het
Mogat2 A T 7: 98,869,102 (GRCm39) H305Q probably damaging Het
Mst1r T A 9: 107,794,465 (GRCm39) Y1215N probably damaging Het
Muc5ac A T 7: 141,343,532 (GRCm39) H48L possibly damaging Het
Myo7b T C 18: 32,116,748 (GRCm39) D953G probably damaging Het
Ocel1 T C 8: 71,824,472 (GRCm39) probably benign Het
Pcdhb6 A G 18: 37,468,978 (GRCm39) D633G probably damaging Het
Ppm1l A G 3: 69,405,230 (GRCm39) I176V probably benign Het
Sall3 C T 18: 81,013,076 (GRCm39) R1120H possibly damaging Het
Sbf1 G A 15: 89,185,070 (GRCm39) P1018S probably benign Het
Setbp1 T C 18: 78,900,472 (GRCm39) Y1065C probably damaging Het
Slc25a2 T C 18: 37,770,776 (GRCm39) probably null Het
Slc4a2 C A 5: 24,640,888 (GRCm39) T729K probably damaging Het
Sptlc2 T C 12: 87,402,305 (GRCm39) E207G probably damaging Het
Sult6b1 A T 17: 79,214,343 (GRCm39) F27I probably benign Het
Syf2 A T 4: 134,661,889 (GRCm39) K84N probably damaging Het
Tmem209 A T 6: 30,497,166 (GRCm39) N183K probably benign Het
Tomm70a A T 16: 56,973,055 (GRCm39) T598S probably benign Het
Ttll13 A G 7: 79,908,052 (GRCm39) T556A probably benign Het
Vmn2r120 A T 17: 57,831,700 (GRCm39) L363* probably null Het
Xpo6 G T 7: 125,707,791 (GRCm39) Q872K probably damaging Het
Xrra1 A C 7: 99,563,671 (GRCm39) S553R probably damaging Het
Zfy1 A T Y: 738,765 (GRCm39) V147E unknown Homo
Zfy2 T C Y: 2,116,267 (GRCm39) I258V probably benign Homo
Other mutations in Tmem232
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Tmem232 APN 17 65,563,569 (GRCm39) missense possibly damaging 0.71
IGL00954:Tmem232 APN 17 65,807,148 (GRCm39) missense probably damaging 1.00
IGL01530:Tmem232 APN 17 65,563,543 (GRCm39) nonsense probably null
IGL02881:Tmem232 APN 17 65,757,365 (GRCm39) missense probably damaging 1.00
IGL02969:Tmem232 APN 17 65,563,558 (GRCm39) missense possibly damaging 0.69
IGL02972:Tmem232 APN 17 65,783,668 (GRCm39) missense probably benign 0.00
IGL03028:Tmem232 APN 17 65,563,384 (GRCm39) missense probably benign 0.14
IGL03293:Tmem232 APN 17 65,757,369 (GRCm39) missense probably damaging 1.00
R0380:Tmem232 UTSW 17 65,563,443 (GRCm39) missense probably benign 0.23
R0432:Tmem232 UTSW 17 65,563,498 (GRCm39) missense probably damaging 0.99
R0524:Tmem232 UTSW 17 65,792,937 (GRCm39) missense probably damaging 0.98
R0548:Tmem232 UTSW 17 65,689,615 (GRCm39) missense probably benign 0.22
R1345:Tmem232 UTSW 17 65,757,401 (GRCm39) missense possibly damaging 0.60
R1521:Tmem232 UTSW 17 65,791,496 (GRCm39) missense probably damaging 0.99
R1954:Tmem232 UTSW 17 65,791,482 (GRCm39) missense probably benign 0.01
R1955:Tmem232 UTSW 17 65,791,482 (GRCm39) missense probably benign 0.01
R2012:Tmem232 UTSW 17 65,807,167 (GRCm39) missense probably benign 0.21
R2294:Tmem232 UTSW 17 65,757,436 (GRCm39) missense probably benign 0.00
R2369:Tmem232 UTSW 17 65,709,992 (GRCm39) missense probably damaging 1.00
R2384:Tmem232 UTSW 17 65,709,852 (GRCm39) missense probably damaging 1.00
R2894:Tmem232 UTSW 17 65,757,408 (GRCm39) missense probably damaging 1.00
R3431:Tmem232 UTSW 17 65,572,297 (GRCm39) splice site probably null
R3788:Tmem232 UTSW 17 65,689,628 (GRCm39) missense possibly damaging 0.71
R3789:Tmem232 UTSW 17 65,689,628 (GRCm39) missense possibly damaging 0.71
R3789:Tmem232 UTSW 17 65,689,520 (GRCm39) missense probably benign 0.02
R4155:Tmem232 UTSW 17 65,743,328 (GRCm39) missense probably damaging 0.97
R4691:Tmem232 UTSW 17 65,572,237 (GRCm39) missense possibly damaging 0.88
R4838:Tmem232 UTSW 17 65,737,883 (GRCm39) missense probably benign 0.04
R5340:Tmem232 UTSW 17 65,709,993 (GRCm39) missense possibly damaging 0.92
R5619:Tmem232 UTSW 17 65,793,506 (GRCm39) missense probably benign 0.06
R6176:Tmem232 UTSW 17 65,792,867 (GRCm39) missense probably damaging 1.00
R6192:Tmem232 UTSW 17 65,737,800 (GRCm39) missense probably damaging 1.00
R6223:Tmem232 UTSW 17 65,807,191 (GRCm39) start codon destroyed probably null 0.99
R6782:Tmem232 UTSW 17 65,807,119 (GRCm39) missense possibly damaging 0.88
R6856:Tmem232 UTSW 17 65,757,305 (GRCm39) missense possibly damaging 0.57
R7262:Tmem232 UTSW 17 65,807,112 (GRCm39) missense probably benign
R7459:Tmem232 UTSW 17 65,563,384 (GRCm39) missense probably benign 0.14
R7699:Tmem232 UTSW 17 65,572,213 (GRCm39) missense probably damaging 0.97
R7700:Tmem232 UTSW 17 65,572,213 (GRCm39) missense probably damaging 0.97
R8284:Tmem232 UTSW 17 65,709,990 (GRCm39) missense probably damaging 1.00
R8523:Tmem232 UTSW 17 65,785,366 (GRCm39) missense probably damaging 1.00
R8821:Tmem232 UTSW 17 65,743,367 (GRCm39) missense probably damaging 1.00
R9016:Tmem232 UTSW 17 65,737,778 (GRCm39) missense probably benign 0.30
R9420:Tmem232 UTSW 17 65,792,881 (GRCm39) missense probably damaging 1.00
R9617:Tmem232 UTSW 17 65,807,180 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACTGAAGAGACACTGCCTG -3'
(R):5'- AGCACTTCAGTCTTGACATAACCG -3'

Sequencing Primer
(F):5'- AGACACTGCCTGGCCCAG -3'
(R):5'- TGAGCATTTACTGGTGCG -3'
Posted On 2018-02-28