Incidental Mutation 'R6256:Pcdhb6'
ID506149
Institutional Source Beutler Lab
Gene Symbol Pcdhb6
Ensembl Gene ENSMUSG00000051678
Gene Nameprotocadherin beta 6
SynonymsPcdhb5B, PcdhbF
MMRRC Submission 044373-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R6256 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37333921-37337674 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37335925 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 633 (D633G)
Ref Sequence ENSEMBL: ENSMUSP00000058592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061717] [ENSMUST00000115661] [ENSMUST00000194544] [ENSMUST00000194655]
Predicted Effect probably damaging
Transcript: ENSMUST00000061717
AA Change: D633G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058592
Gene: ENSMUSG00000051678
AA Change: D633G

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 2.7e-33 PFAM
CA 155 240 1.48e-22 SMART
CA 264 344 3.02e-28 SMART
CA 367 448 1.69e-22 SMART
CA 472 558 1.65e-25 SMART
CA 588 669 6.24e-12 SMART
Pfam:Cadherin_C_2 685 768 4.7e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194655
SMART Domains Protein: ENSMUSP00000141773
Gene: ENSMUSG00000051678

DomainStartEndE-ValueType
Blast:CA 1 60 2e-11 BLAST
Meta Mutation Damage Score 0.2913 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A T 8: 72,451,428 Q361L probably damaging Het
Abca7 A G 10: 80,002,622 T577A probably damaging Het
Acad12 A T 5: 121,614,086 V54E probably benign Het
Ago4 A G 4: 126,520,226 Y91H probably damaging Het
Akr1b10 T C 6: 34,387,688 V28A probably damaging Het
Ccdc33 T A 9: 58,101,918 probably null Het
Ccdc7a T C 8: 128,935,593 probably null Het
Ces1f A T 8: 93,265,794 V343E probably damaging Het
Cftr T C 6: 18,274,661 L896P probably damaging Het
Csmd3 G A 15: 47,669,729 P2375S probably damaging Het
Dnajb14 G C 3: 137,908,362 A345P probably damaging Het
Dnajb14 C T 3: 137,908,363 A345V probably damaging Het
Dnase1 G A 16: 4,037,621 R24K probably benign Het
Dnmbp C T 19: 43,852,281 V560M probably damaging Het
Dopey2 T A 16: 93,807,214 I1981N possibly damaging Het
Eif3a A C 19: 60,771,026 S770A possibly damaging Het
Fbxl7 A T 15: 26,553,002 C60S probably benign Het
Fras1 A T 5: 96,733,843 D2478V possibly damaging Het
Hrnr A G 3: 93,322,611 D52G probably damaging Het
Jmjd1c T A 10: 67,220,408 L823M probably damaging Het
Kdm1a G T 4: 136,568,600 C172* probably null Het
Kdm6b C T 11: 69,406,729 E295K probably damaging Het
Mepe A T 5: 104,337,074 M27L probably benign Het
Mogat2 A T 7: 99,219,895 H305Q probably damaging Het
Mst1r T A 9: 107,917,266 Y1215N probably damaging Het
Muc5ac A T 7: 141,789,795 H48L possibly damaging Het
Myo7b T C 18: 31,983,695 D953G probably damaging Het
Ocel1 T C 8: 71,371,828 probably benign Het
Ppm1l A G 3: 69,497,897 I176V probably benign Het
Sall3 C T 18: 80,969,861 R1120H possibly damaging Het
Sbf1 G A 15: 89,300,867 P1018S probably benign Het
Setbp1 T C 18: 78,857,257 Y1065C probably damaging Het
Slc25a2 T C 18: 37,637,723 probably null Het
Slc4a2 C A 5: 24,435,890 T729K probably damaging Het
Sptlc2 T C 12: 87,355,531 E207G probably damaging Het
Sult6b1 A T 17: 78,906,914 F27I probably benign Het
Syf2 A T 4: 134,934,578 K84N probably damaging Het
Tmem209 A T 6: 30,497,167 N183K probably benign Het
Tmem232 G T 17: 65,478,402 Q188K possibly damaging Het
Tomm70a A T 16: 57,152,692 T598S probably benign Het
Ttll13 A G 7: 80,258,304 T556A probably benign Het
Vmn2r120 A T 17: 57,524,700 L363* probably null Het
Xpo6 G T 7: 126,108,619 Q872K probably damaging Het
Xrra1 A C 7: 99,914,464 S553R probably damaging Het
Zfy1 A T Y: 738,765 V147E unknown Homo
Zfy2 T C Y: 2,116,267 I258V probably benign Homo
Other mutations in Pcdhb6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Pcdhb6 APN 18 37334224 missense probably damaging 1.00
IGL02123:Pcdhb6 APN 18 37335820 missense probably damaging 1.00
IGL02491:Pcdhb6 APN 18 37335682 missense probably damaging 1.00
IGL02496:Pcdhb6 APN 18 37335454 missense probably damaging 1.00
IGL02608:Pcdhb6 APN 18 37334694 missense probably damaging 0.99
IGL03130:Pcdhb6 APN 18 37335587 nonsense probably null
IGL03144:Pcdhb6 APN 18 37334406 missense probably damaging 1.00
IGL03189:Pcdhb6 APN 18 37336152 missense probably damaging 0.98
IGL03203:Pcdhb6 APN 18 37334532 missense possibly damaging 0.95
IGL03388:Pcdhb6 APN 18 37336137 missense probably damaging 0.99
PIT4445001:Pcdhb6 UTSW 18 37335247 missense possibly damaging 0.67
R0571:Pcdhb6 UTSW 18 37335114 missense probably benign 0.01
R0734:Pcdhb6 UTSW 18 37335334 missense probably damaging 0.99
R1727:Pcdhb6 UTSW 18 37334587 missense probably damaging 1.00
R2206:Pcdhb6 UTSW 18 37335580 missense probably benign 0.10
R2207:Pcdhb6 UTSW 18 37335580 missense probably benign 0.10
R2303:Pcdhb6 UTSW 18 37336231 missense probably damaging 1.00
R2401:Pcdhb6 UTSW 18 37335169 missense probably benign 0.35
R3409:Pcdhb6 UTSW 18 37335892 missense probably damaging 1.00
R3411:Pcdhb6 UTSW 18 37335892 missense probably damaging 1.00
R3625:Pcdhb6 UTSW 18 37336140 missense probably damaging 1.00
R3716:Pcdhb6 UTSW 18 37336206 missense probably benign 0.01
R4745:Pcdhb6 UTSW 18 37335373 missense possibly damaging 0.86
R4821:Pcdhb6 UTSW 18 37334328 missense probably damaging 1.00
R5218:Pcdhb6 UTSW 18 37334335 missense possibly damaging 0.95
R5465:Pcdhb6 UTSW 18 37334730 missense probably damaging 0.97
R5522:Pcdhb6 UTSW 18 37334349 missense probably benign
R5556:Pcdhb6 UTSW 18 37334389 missense probably damaging 1.00
R5703:Pcdhb6 UTSW 18 37334700 missense probably benign 0.15
R6154:Pcdhb6 UTSW 18 37334913 missense probably benign 0.00
R6304:Pcdhb6 UTSW 18 37335921 nonsense probably null
R6528:Pcdhb6 UTSW 18 37334503 missense probably damaging 1.00
R6883:Pcdhb6 UTSW 18 37335145 missense probably damaging 1.00
R7045:Pcdhb6 UTSW 18 37336276 missense possibly damaging 0.88
R7307:Pcdhb6 UTSW 18 37335478 missense probably benign
R7313:Pcdhb6 UTSW 18 37335208 missense probably damaging 0.99
R7378:Pcdhb6 UTSW 18 37335172 missense probably damaging 1.00
R7555:Pcdhb6 UTSW 18 37335279 missense possibly damaging 0.60
R7606:Pcdhb6 UTSW 18 37335606 missense probably damaging 0.99
R7701:Pcdhb6 UTSW 18 37334509 missense probably damaging 1.00
R7830:Pcdhb6 UTSW 18 37336312 missense probably benign 0.05
R7905:Pcdhb6 UTSW 18 37334554 missense probably benign 0.00
R7982:Pcdhb6 UTSW 18 37334220 nonsense probably null
R8818:Pcdhb6 UTSW 18 37335784 missense probably benign 0.06
Z1088:Pcdhb6 UTSW 18 37335146 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCTACCCGATGCAGAACG -3'
(R):5'- CCAAGGCAATGACCAGGTAG -3'

Sequencing Primer
(F):5'- TGCACTGAGCTGCTGCC -3'
(R):5'- AGAGTGTGAGCATGTCTTCATCC -3'
Posted On2018-02-28