Incidental Mutation 'R6256:Slc25a2'
ID506151
Institutional Source Beutler Lab
Gene Symbol Slc25a2
Ensembl Gene ENSMUSG00000050304
Gene Namesolute carrier family 25 (mitochondrial carrier, ornithine transporter) member 2
SynonymsOrnt2
MMRRC Submission 044373-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R6256 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37637377-37638745 bp(-) (GRCm38)
Type of Mutationsplice site (2768 bp from exon)
DNA Base Change (assembly) T to C at 37637723 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000065645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058635] [ENSMUST00000066272] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably damaging
Transcript: ENSMUST00000058635
AA Change: Y251C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052849
Gene: ENSMUSG00000050304
AA Change: Y251C

DomainStartEndE-ValueType
Pfam:Mito_carr 1 60 5.9e-11 PFAM
Pfam:Mito_carr 67 165 9.5e-20 PFAM
Pfam:Mito_carr 169 262 8.9e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000066272
SMART Domains Protein: ENSMUSP00000065645
Gene: ENSMUSG00000051316

DomainStartEndE-ValueType
TAFII55_N 12 178 4.63e-94 SMART
low complexity region 225 235 N/A INTRINSIC
coiled coil region 237 341 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.9310 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A T 8: 72,451,428 Q361L probably damaging Het
Abca7 A G 10: 80,002,622 T577A probably damaging Het
Acad12 A T 5: 121,614,086 V54E probably benign Het
Ago4 A G 4: 126,520,226 Y91H probably damaging Het
Akr1b10 T C 6: 34,387,688 V28A probably damaging Het
Ccdc33 T A 9: 58,101,918 probably null Het
Ccdc7a T C 8: 128,935,593 probably null Het
Ces1f A T 8: 93,265,794 V343E probably damaging Het
Cftr T C 6: 18,274,661 L896P probably damaging Het
Csmd3 G A 15: 47,669,729 P2375S probably damaging Het
Dnajb14 G C 3: 137,908,362 A345P probably damaging Het
Dnajb14 C T 3: 137,908,363 A345V probably damaging Het
Dnase1 G A 16: 4,037,621 R24K probably benign Het
Dnmbp C T 19: 43,852,281 V560M probably damaging Het
Dopey2 T A 16: 93,807,214 I1981N possibly damaging Het
Eif3a A C 19: 60,771,026 S770A possibly damaging Het
Fbxl7 A T 15: 26,553,002 C60S probably benign Het
Fras1 A T 5: 96,733,843 D2478V possibly damaging Het
Hrnr A G 3: 93,322,611 D52G probably damaging Het
Jmjd1c T A 10: 67,220,408 L823M probably damaging Het
Kdm1a G T 4: 136,568,600 C172* probably null Het
Kdm6b C T 11: 69,406,729 E295K probably damaging Het
Mepe A T 5: 104,337,074 M27L probably benign Het
Mogat2 A T 7: 99,219,895 H305Q probably damaging Het
Mst1r T A 9: 107,917,266 Y1215N probably damaging Het
Muc5ac A T 7: 141,789,795 H48L possibly damaging Het
Myo7b T C 18: 31,983,695 D953G probably damaging Het
Ocel1 T C 8: 71,371,828 probably benign Het
Pcdhb6 A G 18: 37,335,925 D633G probably damaging Het
Ppm1l A G 3: 69,497,897 I176V probably benign Het
Sall3 C T 18: 80,969,861 R1120H possibly damaging Het
Sbf1 G A 15: 89,300,867 P1018S probably benign Het
Setbp1 T C 18: 78,857,257 Y1065C probably damaging Het
Slc4a2 C A 5: 24,435,890 T729K probably damaging Het
Sptlc2 T C 12: 87,355,531 E207G probably damaging Het
Sult6b1 A T 17: 78,906,914 F27I probably benign Het
Syf2 A T 4: 134,934,578 K84N probably damaging Het
Tmem209 A T 6: 30,497,167 N183K probably benign Het
Tmem232 G T 17: 65,478,402 Q188K possibly damaging Het
Tomm70a A T 16: 57,152,692 T598S probably benign Het
Ttll13 A G 7: 80,258,304 T556A probably benign Het
Vmn2r120 A T 17: 57,524,700 L363* probably null Het
Xpo6 G T 7: 126,108,619 Q872K probably damaging Het
Xrra1 A C 7: 99,914,464 S553R probably damaging Het
Zfy1 A T Y: 738,765 V147E unknown Homo
Zfy2 T C Y: 2,116,267 I258V probably benign Homo
Other mutations in Slc25a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02887:Slc25a2 APN 18 37637886 missense probably benign 0.00
R1632:Slc25a2 UTSW 18 37637687 missense possibly damaging 0.81
R2178:Slc25a2 UTSW 18 37638258 missense probably benign 0.00
R5952:Slc25a2 UTSW 18 37638282 missense probably benign
R7137:Slc25a2 UTSW 18 37638147 missense probably benign 0.00
R7239:Slc25a2 UTSW 18 37637695 missense probably benign 0.00
Z1177:Slc25a2 UTSW 18 37638434 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACAAGGTATGAGATTTGAGG -3'
(R):5'- AACTAGGCCCTGTCCCTTTG -3'

Sequencing Primer
(F):5'- TTTGAGGAAGGGAAGACAAACCC -3'
(R):5'- GGCTTATCATATTCCCAGTGGACTG -3'
Posted On2018-02-28