Incidental Mutation 'R6256:Eif3a'
ID506155
Institutional Source Beutler Lab
Gene Symbol Eif3a
Ensembl Gene ENSMUSG00000024991
Gene Nameeukaryotic translation initiation factor 3, subunit A
SynonymsEif3s10, A830012B05Rik, Eif3, Csma
MMRRC Submission 044373-MU
Accession Numbers

Genbank: NM_010123

Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R6256 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location60761116-60790693 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 60771026 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 770 (S770A)
Ref Sequence ENSEMBL: ENSMUSP00000025955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025955]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025955
AA Change: S770A

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000025955
Gene: ENSMUSG00000024991
AA Change: S770A

DomainStartEndE-ValueType
coiled coil region 82 120 N/A INTRINSIC
PINT 426 506 5.69e-18 SMART
SCOP:d1f5aa2 563 711 5e-3 SMART
coiled coil region 772 880 N/A INTRINSIC
low complexity region 919 947 N/A INTRINSIC
low complexity region 951 976 N/A INTRINSIC
internal_repeat_2 978 991 1.01e-8 PROSPERO
low complexity region 993 1007 N/A INTRINSIC
low complexity region 1013 1027 N/A INTRINSIC
low complexity region 1033 1057 N/A INTRINSIC
low complexity region 1064 1089 N/A INTRINSIC
internal_repeat_1 1090 1111 6.2e-12 PROSPERO
internal_repeat_2 1099 1112 1.01e-8 PROSPERO
internal_repeat_1 1110 1131 6.2e-12 PROSPERO
low complexity region 1146 1173 N/A INTRINSIC
low complexity region 1176 1206 N/A INTRINSIC
low complexity region 1221 1260 N/A INTRINSIC
low complexity region 1265 1297 N/A INTRINSIC
low complexity region 1301 1314 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158973
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199618
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (74/75)
Allele List at MGI

All alleles(36) : Targeted, other(2) Gene trapped(34)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A T 8: 72,451,428 Q361L probably damaging Het
Abca7 A G 10: 80,002,622 T577A probably damaging Het
Acad12 A T 5: 121,614,086 V54E probably benign Het
Ago4 A G 4: 126,520,226 Y91H probably damaging Het
Akr1b10 T C 6: 34,387,688 V28A probably damaging Het
Ccdc33 T A 9: 58,101,918 probably null Het
Ccdc7a T C 8: 128,935,593 probably null Het
Ces1f A T 8: 93,265,794 V343E probably damaging Het
Cftr T C 6: 18,274,661 L896P probably damaging Het
Csmd3 G A 15: 47,669,729 P2375S probably damaging Het
Dnajb14 G C 3: 137,908,362 A345P probably damaging Het
Dnajb14 C T 3: 137,908,363 A345V probably damaging Het
Dnase1 G A 16: 4,037,621 R24K probably benign Het
Dnmbp C T 19: 43,852,281 V560M probably damaging Het
Dopey2 T A 16: 93,807,214 I1981N possibly damaging Het
Fbxl7 A T 15: 26,553,002 C60S probably benign Het
Fras1 A T 5: 96,733,843 D2478V possibly damaging Het
Hrnr A G 3: 93,322,611 D52G probably damaging Het
Jmjd1c T A 10: 67,220,408 L823M probably damaging Het
Kdm1a G T 4: 136,568,600 C172* probably null Het
Kdm6b C T 11: 69,406,729 E295K probably damaging Het
Mepe A T 5: 104,337,074 M27L probably benign Het
Mogat2 A T 7: 99,219,895 H305Q probably damaging Het
Mst1r T A 9: 107,917,266 Y1215N probably damaging Het
Muc5ac A T 7: 141,789,795 H48L possibly damaging Het
Myo7b T C 18: 31,983,695 D953G probably damaging Het
Ocel1 T C 8: 71,371,828 probably benign Het
Pcdhb6 A G 18: 37,335,925 D633G probably damaging Het
Ppm1l A G 3: 69,497,897 I176V probably benign Het
Sall3 C T 18: 80,969,861 R1120H possibly damaging Het
Sbf1 G A 15: 89,300,867 P1018S probably benign Het
Setbp1 T C 18: 78,857,257 Y1065C probably damaging Het
Slc25a2 T C 18: 37,637,723 probably null Het
Slc4a2 C A 5: 24,435,890 T729K probably damaging Het
Sptlc2 T C 12: 87,355,531 E207G probably damaging Het
Sult6b1 A T 17: 78,906,914 F27I probably benign Het
Syf2 A T 4: 134,934,578 K84N probably damaging Het
Tmem209 A T 6: 30,497,167 N183K probably benign Het
Tmem232 G T 17: 65,478,402 Q188K possibly damaging Het
Tomm70a A T 16: 57,152,692 T598S probably benign Het
Ttll13 A G 7: 80,258,304 T556A probably benign Het
Vmn2r120 A T 17: 57,524,700 L363* probably null Het
Xpo6 G T 7: 126,108,619 Q872K probably damaging Het
Xrra1 A C 7: 99,914,464 S553R probably damaging Het
Zfy1 A T Y: 738,765 V147E unknown Homo
Zfy2 T C Y: 2,116,267 I258V probably benign Homo
Other mutations in Eif3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Eif3a APN 19 60769890 missense unknown
IGL00981:Eif3a APN 19 60766611 missense unknown
IGL01650:Eif3a APN 19 60773996 missense probably damaging 1.00
IGL01926:Eif3a APN 19 60769961 missense unknown
IGL02100:Eif3a APN 19 60767004 splice site probably benign
IGL02316:Eif3a APN 19 60771638 splice site probably benign
IGL02444:Eif3a APN 19 60773607 missense possibly damaging 0.89
IGL02552:Eif3a APN 19 60763226 unclassified probably benign
IGL02797:Eif3a APN 19 60772726 missense probably damaging 1.00
IGL03108:Eif3a APN 19 60782309 missense possibly damaging 0.85
FR4304:Eif3a UTSW 19 60775290 critical splice donor site probably benign
FR4548:Eif3a UTSW 19 60775291 critical splice donor site probably benign
FR4737:Eif3a UTSW 19 60775289 critical splice donor site probably benign
FR4976:Eif3a UTSW 19 60775291 critical splice donor site probably benign
G5538:Eif3a UTSW 19 60781902 missense probably damaging 0.97
R0054:Eif3a UTSW 19 60766826 missense unknown
R0054:Eif3a UTSW 19 60766826 missense unknown
R1483:Eif3a UTSW 19 60768726 missense unknown
R1636:Eif3a UTSW 19 60781905 missense possibly damaging 0.93
R1748:Eif3a UTSW 19 60766798 missense unknown
R1857:Eif3a UTSW 19 60782197 missense probably damaging 1.00
R1858:Eif3a UTSW 19 60782197 missense probably damaging 1.00
R1993:Eif3a UTSW 19 60781516 missense probably benign 0.19
R2034:Eif3a UTSW 19 60762130 unclassified probably benign
R2099:Eif3a UTSW 19 60764113 unclassified probably benign
R2140:Eif3a UTSW 19 60775394 splice site probably benign
R2434:Eif3a UTSW 19 60764050 unclassified probably benign
R2940:Eif3a UTSW 19 60773677 missense probably benign 0.22
R4630:Eif3a UTSW 19 60769928 missense unknown
R4630:Eif3a UTSW 19 60777986 missense probably benign 0.41
R4926:Eif3a UTSW 19 60763218 unclassified probably benign
R5366:Eif3a UTSW 19 60779533 missense probably benign 0.12
R6003:Eif3a UTSW 19 60766881 missense unknown
R6082:Eif3a UTSW 19 60772130 missense possibly damaging 0.82
R7056:Eif3a UTSW 19 60763062 splice site probably null
R7365:Eif3a UTSW 19 60766644 missense unknown
R7922:Eif3a UTSW 19 60775842 missense probably damaging 1.00
R8076:Eif3a UTSW 19 60773925 missense probably damaging 0.97
R8169:Eif3a UTSW 19 60762190 missense unknown
R8246:Eif3a UTSW 19 60779368 missense probably damaging 1.00
R8474:Eif3a UTSW 19 60779491 missense possibly damaging 0.63
R8546:Eif3a UTSW 19 60766770 missense unknown
X0028:Eif3a UTSW 19 60781902 missense probably damaging 0.97
X0066:Eif3a UTSW 19 60762293 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGAAATTCCATCCTGCACTGCC -3'
(R):5'- GTGAGCATCTTCCTGGAGTG -3'

Sequencing Primer
(F):5'- TGCACTGCCCCCAAAATC -3'
(R):5'- GATGCTTTGGAGATTACCTAGTGC -3'
Posted On2018-02-28