Mutagenetix > Incidental Mutation

Incidental Mutation 'R6256:Eif3a'

506155

Institutional Source

Beutler Lab

Gene Symbol

Eif3a

Ensembl Gene

ENSMUSG00000024991

Gene Name

eukaryotic translation initiation factor 3, subunit A

Synonyms

Eif3s10, A830012B05Rik, Eif3, Csma

MMRRC Submission

044373-MU

Accession Numbers

Genbank: NM_010123

Is this an essential gene?

Probably essential (E-score: 0.966) question?

Stock #

R6256 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

60761116-60790693 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 60771026 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 770 (S770A)

Ref Sequence

ENSEMBL: ENSMUSP00000025955 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025955]

AlphaFold

P23116

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025955
AA Change: S770A

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000025955
Gene: ENSMUSG00000024991
AA Change: S770A

Domain	Start	End	E-Value	Type
coiled coil region	82	120	N/A	INTRINSIC
PINT	426	506	5.69e-18	SMART
SCOP:d1f5aa2	563	711	5e-3	SMART
coiled coil region	772	880	N/A	INTRINSIC
low complexity region	919	947	N/A	INTRINSIC
low complexity region	951	976	N/A	INTRINSIC
internal_repeat_2	978	991	1.01e-8	PROSPERO
low complexity region	993	1007	N/A	INTRINSIC
low complexity region	1013	1027	N/A	INTRINSIC
low complexity region	1033	1057	N/A	INTRINSIC
low complexity region	1064	1089	N/A	INTRINSIC
internal_repeat_1	1090	1111	6.2e-12	PROSPERO
internal_repeat_2	1099	1112	1.01e-8	PROSPERO
internal_repeat_1	1110	1131	6.2e-12	PROSPERO
low complexity region	1146	1173	N/A	INTRINSIC
low complexity region	1176	1206	N/A	INTRINSIC
low complexity region	1221	1260	N/A	INTRINSIC
low complexity region	1265	1297	N/A	INTRINSIC
low complexity region	1301	1314	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000082962

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158973

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199618

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.5%

Validation Efficiency

99% (74/75)

Allele List at MGI

All alleles(36) : Targeted, other(2) Gene trapped(34)

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030K09Rik	A	T	8: 72,451,428	Q361L	probably damaging	Het
Abca7	A	G	10: 80,002,622	T577A	probably damaging	Het
Acad12	A	T	5: 121,614,086	V54E	probably benign	Het
Ago4	A	G	4: 126,520,226	Y91H	probably damaging	Het
Akr1b10	T	C	6: 34,387,688	V28A	probably damaging	Het
Ccdc33	T	A	9: 58,101,918		probably null	Het
Ccdc7a	T	C	8: 128,935,593		probably null	Het
Ces1f	A	T	8: 93,265,794	V343E	probably damaging	Het
Cftr	T	C	6: 18,274,661	L896P	probably damaging	Het
Csmd3	G	A	15: 47,669,729	P2375S	probably damaging	Het
Dnajb14	G	C	3: 137,908,362	A345P	probably damaging	Het
Dnajb14	C	T	3: 137,908,363	A345V	probably damaging	Het
Dnase1	G	A	16: 4,037,621	R24K	probably benign	Het
Dnmbp	C	T	19: 43,852,281	V560M	probably damaging	Het
Dopey2	T	A	16: 93,807,214	I1981N	possibly damaging	Het
Fbxl7	A	T	15: 26,553,002	C60S	probably benign	Het
Fras1	A	T	5: 96,733,843	D2478V	possibly damaging	Het
Hrnr	A	G	3: 93,322,611	D52G	probably damaging	Het
Jmjd1c	T	A	10: 67,220,408	L823M	probably damaging	Het
Kdm1a	G	T	4: 136,568,600	C172*	probably null	Het
Kdm6b	C	T	11: 69,406,729	E295K	probably damaging	Het
Mepe	A	T	5: 104,337,074	M27L	probably benign	Het
Mogat2	A	T	7: 99,219,895	H305Q	probably damaging	Het
Mst1r	T	A	9: 107,917,266	Y1215N	probably damaging	Het
Muc5ac	A	T	7: 141,789,795	H48L	possibly damaging	Het
Myo7b	T	C	18: 31,983,695	D953G	probably damaging	Het
Ocel1	T	C	8: 71,371,828		probably benign	Het
Pcdhb6	A	G	18: 37,335,925	D633G	probably damaging	Het
Ppm1l	A	G	3: 69,497,897	I176V	probably benign	Het
Sall3	C	T	18: 80,969,861	R1120H	possibly damaging	Het
Sbf1	G	A	15: 89,300,867	P1018S	probably benign	Het
Setbp1	T	C	18: 78,857,257	Y1065C	probably damaging	Het
Slc25a2	T	C	18: 37,637,723		probably null	Het
Slc4a2	C	A	5: 24,435,890	T729K	probably damaging	Het
Sptlc2	T	C	12: 87,355,531	E207G	probably damaging	Het
Sult6b1	A	T	17: 78,906,914	F27I	probably benign	Het
Syf2	A	T	4: 134,934,578	K84N	probably damaging	Het
Tmem209	A	T	6: 30,497,167	N183K	probably benign	Het
Tmem232	G	T	17: 65,478,402	Q188K	possibly damaging	Het
Tomm70a	A	T	16: 57,152,692	T598S	probably benign	Het
Ttll13	A	G	7: 80,258,304	T556A	probably benign	Het
Vmn2r120	A	T	17: 57,524,700	L363*	probably null	Het
Xpo6	G	T	7: 126,108,619	Q872K	probably damaging	Het
Xrra1	A	C	7: 99,914,464	S553R	probably damaging	Het
Zfy1	A	T	Y: 738,765	V147E	unknown	Homo
Zfy2	T	C	Y: 2,116,267	I258V	probably benign	Homo

Other mutations in Eif3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Eif3a	APN	19	60769890	missense	unknown
IGL00981:Eif3a	APN	19	60766611	missense	unknown
IGL01650:Eif3a	APN	19	60773996	missense	probably damaging	1.00
IGL01926:Eif3a	APN	19	60769961	missense	unknown
IGL02100:Eif3a	APN	19	60767004	splice site	probably benign
IGL02316:Eif3a	APN	19	60771638	splice site	probably benign
IGL02444:Eif3a	APN	19	60773607	missense	possibly damaging	0.89
IGL02552:Eif3a	APN	19	60763226	unclassified	probably benign
IGL02797:Eif3a	APN	19	60772726	missense	probably damaging	1.00
IGL03108:Eif3a	APN	19	60782309	missense	possibly damaging	0.85
FR4304:Eif3a	UTSW	19	60775290	critical splice donor site	probably benign
FR4548:Eif3a	UTSW	19	60775291	critical splice donor site	probably benign
FR4737:Eif3a	UTSW	19	60775289	critical splice donor site	probably benign
FR4976:Eif3a	UTSW	19	60775291	critical splice donor site	probably benign
G5538:Eif3a	UTSW	19	60781902	missense	probably damaging	0.97
R0054:Eif3a	UTSW	19	60766826	missense	unknown
R0054:Eif3a	UTSW	19	60766826	missense	unknown
R1483:Eif3a	UTSW	19	60768726	missense	unknown
R1636:Eif3a	UTSW	19	60781905	missense	possibly damaging	0.93
R1748:Eif3a	UTSW	19	60766798	missense	unknown
R1857:Eif3a	UTSW	19	60782197	missense	probably damaging	1.00
R1858:Eif3a	UTSW	19	60782197	missense	probably damaging	1.00
R1993:Eif3a	UTSW	19	60781516	missense	probably benign	0.19
R2034:Eif3a	UTSW	19	60762130	unclassified	probably benign
R2099:Eif3a	UTSW	19	60764113	unclassified	probably benign
R2140:Eif3a	UTSW	19	60775394	splice site	probably benign
R2434:Eif3a	UTSW	19	60764050	unclassified	probably benign
R2940:Eif3a	UTSW	19	60773677	missense	probably benign	0.22
R4630:Eif3a	UTSW	19	60769928	missense	unknown
R4630:Eif3a	UTSW	19	60777986	missense	probably benign	0.41
R4926:Eif3a	UTSW	19	60763218	unclassified	probably benign
R5366:Eif3a	UTSW	19	60779533	missense	probably benign	0.12
R6003:Eif3a	UTSW	19	60766881	missense	unknown
R6082:Eif3a	UTSW	19	60772130	missense	possibly damaging	0.82
R7056:Eif3a	UTSW	19	60763062	splice site	probably null
R7365:Eif3a	UTSW	19	60766644	missense	unknown
R7922:Eif3a	UTSW	19	60775842	missense	probably damaging	1.00
R8076:Eif3a	UTSW	19	60773925	missense	probably damaging	0.97
R8169:Eif3a	UTSW	19	60762190	missense	unknown
R8246:Eif3a	UTSW	19	60779368	missense	probably damaging	1.00
R8474:Eif3a	UTSW	19	60779491	missense	possibly damaging	0.63
R8546:Eif3a	UTSW	19	60766770	missense	unknown
R8964:Eif3a	UTSW	19	60763192	missense	unknown
R9071:Eif3a	UTSW	19	60763196	missense	unknown
R9290:Eif3a	UTSW	19	60776783	missense	probably damaging	1.00
R9484:Eif3a	UTSW	19	60766568	missense	unknown
R9780:Eif3a	UTSW	19	60777960	missense	probably damaging	1.00
X0028:Eif3a	UTSW	19	60781902	missense	probably damaging	0.97
X0066:Eif3a	UTSW	19	60762293	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- TGAAATTCCATCCTGCACTGCC -3'
(R):5'- GTGAGCATCTTCCTGGAGTG -3'

Sequencing Primer
(F):5'- TGCACTGCCCCCAAAATC -3'
(R):5'- GATGCTTTGGAGATTACCTAGTGC -3'

Posted On

2018-02-28