Incidental Mutation 'R6256:Zfy1'
ID506156
Institutional Source Beutler Lab
Gene Symbol Zfy1
Ensembl Gene ENSMUSG00000053211
Gene Namezinc finger protein 1, Y-linked
SynonymsZfy-1
MMRRC Submission 044373-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.047) question?
Stock #R6256 (G1)
Quality Score221.999
Status Validated
ChromosomeY
Chromosomal Location725128-797409 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 738765 bp
ZygosityHomozygous
Amino Acid Change Valine to Glutamic Acid at position 147 (V147E)
Ref Sequence ENSEMBL: ENSMUSP00000140600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065545] [ENSMUST00000189888]
Predicted Effect unknown
Transcript: ENSMUST00000065545
AA Change: V147E
SMART Domains Protein: ENSMUSP00000069364
Gene: ENSMUSG00000053211
AA Change: V147E

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:Zfx_Zfy_act 68 388 1.1e-109 PFAM
ZnF_C2H2 403 425 1.95e-3 SMART
ZnF_C2H2 434 456 1.26e-2 SMART
ZnF_C2H2 466 488 1.05e1 SMART
ZnF_C2H2 497 520 1.41e0 SMART
ZnF_C2H2 526 548 3.69e-4 SMART
ZnF_C2H2 554 577 3.63e-3 SMART
ZnF_C2H2 583 605 8.98e0 SMART
ZnF_C2H2 611 634 3.58e-2 SMART
ZnF_C2H2 640 662 2.95e-3 SMART
ZnF_C2H2 668 691 3.47e0 SMART
ZnF_C2H2 697 719 1.45e-2 SMART
ZnF_C2H2 725 748 1.2e-3 SMART
ZnF_C2H2 754 776 5.81e-2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000189888
AA Change: V147E
SMART Domains Protein: ENSMUSP00000140600
Gene: ENSMUSG00000053211
AA Change: V147E

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:Zfx_Zfy_act 67 388 1.2e-141 PFAM
ZnF_C2H2 403 425 1.95e-3 SMART
ZnF_C2H2 434 456 1.26e-2 SMART
ZnF_C2H2 466 488 1.05e1 SMART
ZnF_C2H2 497 520 1.41e0 SMART
ZnF_C2H2 526 548 3.69e-4 SMART
ZnF_C2H2 554 577 3.63e-3 SMART
ZnF_C2H2 583 605 8.98e0 SMART
ZnF_C2H2 611 634 3.58e-2 SMART
ZnF_C2H2 640 662 2.95e-3 SMART
ZnF_C2H2 668 691 3.47e0 SMART
ZnF_C2H2 697 719 1.45e-2 SMART
ZnF_C2H2 725 748 1.2e-3 SMART
ZnF_C2H2 754 776 5.81e-2 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A T 8: 72,451,428 Q361L probably damaging Het
Abca7 A G 10: 80,002,622 T577A probably damaging Het
Acad12 A T 5: 121,614,086 V54E probably benign Het
Ago4 A G 4: 126,520,226 Y91H probably damaging Het
Akr1b10 T C 6: 34,387,688 V28A probably damaging Het
Ccdc33 T A 9: 58,101,918 probably null Het
Ccdc7a T C 8: 128,935,593 probably null Het
Ces1f A T 8: 93,265,794 V343E probably damaging Het
Cftr T C 6: 18,274,661 L896P probably damaging Het
Csmd3 G A 15: 47,669,729 P2375S probably damaging Het
Dnajb14 G C 3: 137,908,362 A345P probably damaging Het
Dnajb14 C T 3: 137,908,363 A345V probably damaging Het
Dnase1 G A 16: 4,037,621 R24K probably benign Het
Dnmbp C T 19: 43,852,281 V560M probably damaging Het
Dopey2 T A 16: 93,807,214 I1981N possibly damaging Het
Eif3a A C 19: 60,771,026 S770A possibly damaging Het
Fbxl7 A T 15: 26,553,002 C60S probably benign Het
Fras1 A T 5: 96,733,843 D2478V possibly damaging Het
Hrnr A G 3: 93,322,611 D52G probably damaging Het
Jmjd1c T A 10: 67,220,408 L823M probably damaging Het
Kdm1a G T 4: 136,568,600 C172* probably null Het
Kdm6b C T 11: 69,406,729 E295K probably damaging Het
Mepe A T 5: 104,337,074 M27L probably benign Het
Mogat2 A T 7: 99,219,895 H305Q probably damaging Het
Mst1r T A 9: 107,917,266 Y1215N probably damaging Het
Muc5ac A T 7: 141,789,795 H48L possibly damaging Het
Myo7b T C 18: 31,983,695 D953G probably damaging Het
Ocel1 T C 8: 71,371,828 probably benign Het
Pcdhb6 A G 18: 37,335,925 D633G probably damaging Het
Ppm1l A G 3: 69,497,897 I176V probably benign Het
Sall3 C T 18: 80,969,861 R1120H possibly damaging Het
Sbf1 G A 15: 89,300,867 P1018S probably benign Het
Setbp1 T C 18: 78,857,257 Y1065C probably damaging Het
Slc25a2 T C 18: 37,637,723 probably null Het
Slc4a2 C A 5: 24,435,890 T729K probably damaging Het
Sptlc2 T C 12: 87,355,531 E207G probably damaging Het
Sult6b1 A T 17: 78,906,914 F27I probably benign Het
Syf2 A T 4: 134,934,578 K84N probably damaging Het
Tmem209 A T 6: 30,497,167 N183K probably benign Het
Tmem232 G T 17: 65,478,402 Q188K possibly damaging Het
Tomm70a A T 16: 57,152,692 T598S probably benign Het
Ttll13 A G 7: 80,258,304 T556A probably benign Het
Vmn2r120 A T 17: 57,524,700 L363* probably null Het
Xpo6 G T 7: 126,108,619 Q872K probably damaging Het
Xrra1 A C 7: 99,914,464 S553R probably damaging Het
Zfy2 T C Y: 2,116,267 I258V probably benign Homo
Other mutations in Zfy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0149:Zfy1 UTSW Y 726121 missense possibly damaging 0.95
R0361:Zfy1 UTSW Y 726121 missense possibly damaging 0.95
R0529:Zfy1 UTSW Y 726040 missense probably damaging 1.00
R0837:Zfy1 UTSW Y 725850 nonsense probably null
R0945:Zfy1 UTSW Y 725983 missense probably damaging 0.98
R1163:Zfy1 UTSW Y 725611 missense probably damaging 0.98
R1394:Zfy1 UTSW Y 725957 missense possibly damaging 0.79
R1806:Zfy1 UTSW Y 725620 missense possibly damaging 0.88
R1928:Zfy1 UTSW Y 729733 missense unknown
R2374:Zfy1 UTSW Y 726391 missense probably damaging 0.99
R2374:Zfy1 UTSW Y 726392 missense possibly damaging 0.77
R2889:Zfy1 UTSW Y 726307 missense possibly damaging 0.95
R2980:Zfy1 UTSW Y 739054 missense unknown
R3437:Zfy1 UTSW Y 726357 missense possibly damaging 0.82
R4454:Zfy1 UTSW Y 725518 missense possibly damaging 0.86
R4529:Zfy1 UTSW Y 726511 missense possibly damaging 0.93
R4656:Zfy1 UTSW Y 729626 missense unknown
R5049:Zfy1 UTSW Y 726004 missense possibly damaging 0.93
R5087:Zfy1 UTSW Y 732964 missense unknown
R5347:Zfy1 UTSW Y 725950 missense possibly damaging 0.90
R5428:Zfy1 UTSW Y 726205 missense possibly damaging 0.95
R5825:Zfy1 UTSW Y 726531 missense possibly damaging 0.85
R7065:Zfy1 UTSW Y 725428 missense probably benign 0.33
R7134:Zfy1 UTSW Y 725788 missense probably damaging 0.99
R7185:Zfy1 UTSW Y 725464 missense possibly damaging 0.53
R7358:Zfy1 UTSW Y 735141 missense unknown
R7513:Zfy1 UTSW Y 759852 missense unknown
R7747:Zfy1 UTSW Y 725496 nonsense probably null
R7900:Zfy1 UTSW Y 725519 missense possibly damaging 0.53
R8052:Zfy1 UTSW Y 726004 missense possibly damaging 0.93
R8377:Zfy1 UTSW Y 725723 missense possibly damaging 0.90
R8795:Zfy1 UTSW Y 738945 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGTGGCTCAAGACTTACAAGAC -3'
(R):5'- CCAGGCTCAGTTATAATTCAAGATG -3'

Sequencing Primer
(F):5'- CATCATCAGATAATCCTCACAGTTG -3'
(R):5'- CTGACAATGTCATTATTCCTGAGC -3'
Posted On2018-02-28