Incidental Mutation 'R6256:Zfy2'
ID506157
Institutional Source Beutler Lab
Gene Symbol Zfy2
Ensembl Gene ENSMUSG00000000103
Gene Namezinc finger protein 2, Y-linked
SynonymsZfy-2
MMRRC Submission 044373-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6256 (G1)
Quality Score221.999
Status Validated
ChromosomeY
Chromosomal Location2106015-2170409 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 2116267 bp
ZygosityHomozygous
Amino Acid Change Isoleucine to Valine at position 258 (I258V)
Ref Sequence ENSEMBL: ENSMUSP00000139591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115891] [ENSMUST00000187148]
Predicted Effect probably benign
Transcript: ENSMUST00000115891
AA Change: I258V

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000111557
Gene: ENSMUSG00000000103
AA Change: I258V

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:Zfx_Zfy_act 68 388 1.1e-115 PFAM
ZnF_C2H2 403 425 3.69e-4 SMART
ZnF_C2H2 434 456 1.26e-2 SMART
ZnF_C2H2 491 514 1.41e0 SMART
ZnF_C2H2 520 542 3.69e-4 SMART
ZnF_C2H2 548 571 3.63e-3 SMART
ZnF_C2H2 577 599 1.02e1 SMART
ZnF_C2H2 605 628 3.58e-2 SMART
ZnF_C2H2 634 656 2.95e-3 SMART
ZnF_C2H2 662 685 1.23e0 SMART
ZnF_C2H2 691 713 1.45e-2 SMART
ZnF_C2H2 719 742 1.2e-3 SMART
ZnF_C2H2 748 770 3.34e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187148
AA Change: I258V

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000139591
Gene: ENSMUSG00000000103
AA Change: I258V

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:Zfx_Zfy_act 67 388 2.6e-149 PFAM
ZnF_C2H2 403 425 3.69e-4 SMART
ZnF_C2H2 434 456 1.26e-2 SMART
ZnF_C2H2 491 514 1.41e0 SMART
ZnF_C2H2 520 542 3.69e-4 SMART
ZnF_C2H2 548 571 3.63e-3 SMART
ZnF_C2H2 577 599 1.02e1 SMART
ZnF_C2H2 605 628 3.58e-2 SMART
ZnF_C2H2 634 656 2.95e-3 SMART
ZnF_C2H2 662 685 1.23e0 SMART
ZnF_C2H2 691 713 1.45e-2 SMART
ZnF_C2H2 719 742 1.2e-3 SMART
ZnF_C2H2 748 770 3.34e-2 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A T 8: 72,451,428 Q361L probably damaging Het
Abca7 A G 10: 80,002,622 T577A probably damaging Het
Acad12 A T 5: 121,614,086 V54E probably benign Het
Ago4 A G 4: 126,520,226 Y91H probably damaging Het
Akr1b10 T C 6: 34,387,688 V28A probably damaging Het
Ccdc33 T A 9: 58,101,918 probably null Het
Ccdc7a T C 8: 128,935,593 probably null Het
Ces1f A T 8: 93,265,794 V343E probably damaging Het
Cftr T C 6: 18,274,661 L896P probably damaging Het
Csmd3 G A 15: 47,669,729 P2375S probably damaging Het
Dnajb14 G C 3: 137,908,362 A345P probably damaging Het
Dnajb14 C T 3: 137,908,363 A345V probably damaging Het
Dnase1 G A 16: 4,037,621 R24K probably benign Het
Dnmbp C T 19: 43,852,281 V560M probably damaging Het
Dopey2 T A 16: 93,807,214 I1981N possibly damaging Het
Eif3a A C 19: 60,771,026 S770A possibly damaging Het
Fbxl7 A T 15: 26,553,002 C60S probably benign Het
Fras1 A T 5: 96,733,843 D2478V possibly damaging Het
Hrnr A G 3: 93,322,611 D52G probably damaging Het
Jmjd1c T A 10: 67,220,408 L823M probably damaging Het
Kdm1a G T 4: 136,568,600 C172* probably null Het
Kdm6b C T 11: 69,406,729 E295K probably damaging Het
Mepe A T 5: 104,337,074 M27L probably benign Het
Mogat2 A T 7: 99,219,895 H305Q probably damaging Het
Mst1r T A 9: 107,917,266 Y1215N probably damaging Het
Muc5ac A T 7: 141,789,795 H48L possibly damaging Het
Myo7b T C 18: 31,983,695 D953G probably damaging Het
Ocel1 T C 8: 71,371,828 probably benign Het
Pcdhb6 A G 18: 37,335,925 D633G probably damaging Het
Ppm1l A G 3: 69,497,897 I176V probably benign Het
Sall3 C T 18: 80,969,861 R1120H possibly damaging Het
Sbf1 G A 15: 89,300,867 P1018S probably benign Het
Setbp1 T C 18: 78,857,257 Y1065C probably damaging Het
Slc25a2 T C 18: 37,637,723 probably null Het
Slc4a2 C A 5: 24,435,890 T729K probably damaging Het
Sptlc2 T C 12: 87,355,531 E207G probably damaging Het
Sult6b1 A T 17: 78,906,914 F27I probably benign Het
Syf2 A T 4: 134,934,578 K84N probably damaging Het
Tmem209 A T 6: 30,497,167 N183K probably benign Het
Tmem232 G T 17: 65,478,402 Q188K possibly damaging Het
Tomm70a A T 16: 57,152,692 T598S probably benign Het
Ttll13 A G 7: 80,258,304 T556A probably benign Het
Vmn2r120 A T 17: 57,524,700 L363* probably null Het
Xpo6 G T 7: 126,108,619 Q872K probably damaging Het
Xrra1 A C 7: 99,914,464 S553R probably damaging Het
Zfy1 A T Y: 738,765 V147E unknown Homo
Other mutations in Zfy2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02850:Zfy2 APN Y 2106894 missense probably benign 0.01
IGL02850:Zfy2 APN Y 2117188 missense probably benign 0.00
IGL02851:Zfy2 APN Y 2106894 missense probably benign 0.01
IGL02851:Zfy2 APN Y 2117188 missense probably benign 0.00
IGL02852:Zfy2 APN Y 2106894 missense probably benign 0.01
IGL02852:Zfy2 APN Y 2117188 missense probably benign 0.00
PIT4515001:Zfy2 UTSW Y 2117096 missense probably benign 0.09
R0426:Zfy2 UTSW Y 2107348 missense possibly damaging 0.61
R0490:Zfy2 UTSW Y 2106620 missense possibly damaging 0.89
R1080:Zfy2 UTSW Y 2121645 missense probably benign 0.00
R1513:Zfy2 UTSW Y 2116185 missense probably benign 0.00
R1935:Zfy2 UTSW Y 2121496 missense probably benign 0.02
R1936:Zfy2 UTSW Y 2121496 missense probably benign 0.02
R2358:Zfy2 UTSW Y 2107272 missense possibly damaging 0.61
R4484:Zfy2 UTSW Y 2107351 missense possibly damaging 0.86
R4754:Zfy2 UTSW Y 2121477 missense probably benign 0.02
R4777:Zfy2 UTSW Y 2116194 missense probably benign 0.00
R4812:Zfy2 UTSW Y 2106334 missense probably benign 0.08
R5045:Zfy2 UTSW Y 2107159 missense possibly damaging 0.77
R5363:Zfy2 UTSW Y 2106555 missense possibly damaging 0.95
R6618:Zfy2 UTSW Y 2121477 missense probably benign 0.10
R6941:Zfy2 UTSW Y 2121491 missense probably benign 0.02
R7011:Zfy2 UTSW Y 2107127 missense possibly damaging 0.59
R7712:Zfy2 UTSW Y 2121420 missense probably benign 0.05
R7759:Zfy2 UTSW Y 2117083 missense probably benign 0.02
R7985:Zfy2 UTSW Y 2116263 missense probably benign 0.00
R8051:Zfy2 UTSW Y 2117380 intron probably benign
R8218:Zfy2 UTSW Y 2133421 missense unknown
R8345:Zfy2 UTSW Y 2107096 missense possibly damaging 0.95
R8371:Zfy2 UTSW Y 2117168 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCATAATAATCTCTATGCAGGTCTG -3'
(R):5'- TGCCACCAGACCCTGATATTAC -3'

Sequencing Primer
(F):5'- CAGGTCTGCTGTTATACTGCTTGC -3'
(R):5'- GGAAAGCTTCTTTGAACGTT -3'
Posted On2018-02-28