Incidental Mutation 'R6047:Nfyc'
ID 506158
Institutional Source Beutler Lab
Gene Symbol Nfyc
Ensembl Gene ENSMUSG00000032897
Gene Name nuclear transcription factor-Y gamma
Synonyms
MMRRC Submission 044215-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock # R6047 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 120757438-120831572 bp(-) (GRCm38)
Type of Mutation splice site (3 bp from exon)
DNA Base Change (assembly) T to A at 120779117 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043429] [ENSMUST00000097906] [ENSMUST00000118902] [ENSMUST00000120779] [ENSMUST00000134979] [ENSMUST00000136236] [ENSMUST00000145658]
AlphaFold P70353
Predicted Effect probably null
Transcript: ENSMUST00000043429
SMART Domains Protein: ENSMUSP00000047441
Gene: ENSMUSG00000032897

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Histone 36 107 2.5e-13 PFAM
Pfam:CBFD_NFYB_HMF 41 105 4.5e-23 PFAM
low complexity region 150 190 N/A INTRINSIC
low complexity region 193 231 N/A INTRINSIC
low complexity region 275 297 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000097906
SMART Domains Protein: ENSMUSP00000095516
Gene: ENSMUSG00000032897

DomainStartEndE-ValueType
Pfam:Histone 9 107 7.2e-17 PFAM
Pfam:CBFD_NFYB_HMF 41 105 7.8e-23 PFAM
low complexity region 150 190 N/A INTRINSIC
low complexity region 193 231 N/A INTRINSIC
low complexity region 275 297 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118902
SMART Domains Protein: ENSMUSP00000112610
Gene: ENSMUSG00000032897

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Histone 36 107 2.5e-13 PFAM
Pfam:CBFD_NFYB_HMF 41 105 4.5e-23 PFAM
low complexity region 150 190 N/A INTRINSIC
low complexity region 193 231 N/A INTRINSIC
low complexity region 275 297 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120779
SMART Domains Protein: ENSMUSP00000112810
Gene: ENSMUSG00000032897

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Histone 36 107 2.5e-13 PFAM
Pfam:CBFD_NFYB_HMF 41 105 4.5e-23 PFAM
low complexity region 150 190 N/A INTRINSIC
low complexity region 193 231 N/A INTRINSIC
low complexity region 275 297 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134979
SMART Domains Protein: ENSMUSP00000114640
Gene: ENSMUSG00000032897

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
PDB:1N1J|B 23 58 8e-9 PDB
low complexity region 88 128 N/A INTRINSIC
low complexity region 132 163 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136236
SMART Domains Protein: ENSMUSP00000117646
Gene: ENSMUSG00000032897

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:CBFD_NFYB_HMF 41 70 5.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145658
SMART Domains Protein: ENSMUSP00000114591
Gene: ENSMUSG00000032897

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
SCOP:d1b67a_ 25 53 3e-3 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one subunit of a trimeric complex forming a highly conserved transcription factor that binds with high specificity to CCAAT motifs in the promoters of a variety of genes. The encoded protein, subunit C, forms a tight dimer with the B subunit, a prerequisite for subunit A association. The resulting trimer binds to DNA with high specificity and affinity. Subunits B and C each contain a histone-like motif. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,806,066 I58T probably damaging Het
Adgrb2 G T 4: 130,018,705 G1208C probably damaging Het
Antxrl T C 14: 34,053,476 probably benign Het
Appl2 C T 10: 83,612,901 probably null Het
Bloc1s2 T C 19: 44,142,190 I112V possibly damaging Het
Cblb G T 16: 52,112,248 probably null Het
Cdk9 T C 2: 32,708,273 probably null Het
Dok7 G A 5: 35,079,307 G206D probably damaging Het
Ftsj3 C T 11: 106,252,318 R390H probably damaging Het
Gpr179 G T 11: 97,338,416 P971Q probably damaging Het
Hic1 A T 11: 75,166,849 S405T possibly damaging Het
Ifngr1 T C 10: 19,606,313 L217P probably damaging Het
Insrr A G 3: 87,804,176 K468E probably damaging Het
Lce1j G C 3: 92,789,196 R92G unknown Het
Lrp12 T C 15: 39,872,067 E823G probably damaging Het
Lrp1b A G 2: 40,637,775 I98T probably benign Het
Mbd3l2 A T 9: 18,444,916 H179L possibly damaging Het
Med24 A T 11: 98,707,765 C691* probably null Het
Mical1 T C 10: 41,481,707 probably null Het
Msantd2 A T 9: 37,523,442 Y326F probably damaging Het
Nrg3 T A 14: 38,397,352 probably null Het
Nt5c3 G A 6: 56,882,979 S291L probably damaging Het
Pak4 A G 7: 28,563,036 Y384H probably benign Het
Pdia5 T C 16: 35,397,478 K512E probably damaging Het
Pfpl T C 19: 12,429,233 F283L probably damaging Het
Pick1 A G 15: 79,255,695 probably benign Het
Pkd1 T C 17: 24,595,085 V4143A probably damaging Het
Ptprc C T 1: 138,101,041 probably null Het
Scn10a A G 9: 119,622,831 F1342S probably benign Het
Slc17a7 A T 7: 45,173,406 I436F probably benign Het
Slc34a1 G T 13: 55,412,071 A403S probably damaging Het
Stmn3 A T 2: 181,309,159 Y35N possibly damaging Het
Tldc2 A G 2: 157,096,462 E207G probably damaging Het
Unc79 A G 12: 103,061,458 N436S probably damaging Het
Uty G T Y: 1,158,288 P538Q probably damaging Het
Zzef1 A G 11: 72,866,095 D1142G probably damaging Het
Other mutations in Nfyc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Nfyc APN 4 120781547 intron probably benign
IGL01522:Nfyc APN 4 120781524 missense probably damaging 1.00
IGL01673:Nfyc APN 4 120779110 unclassified probably benign
IGL03197:Nfyc APN 4 120773761 missense probably damaging 1.00
PIT4378001:Nfyc UTSW 4 120790491 critical splice acceptor site probably null
R0638:Nfyc UTSW 4 120768884 missense probably benign 0.19
R0725:Nfyc UTSW 4 120768734 unclassified probably benign
R0842:Nfyc UTSW 4 120759377 missense probably benign 0.16
R1480:Nfyc UTSW 4 120768724 critical splice donor site probably null
R1535:Nfyc UTSW 4 120761724 missense probably damaging 0.99
R1940:Nfyc UTSW 4 120773664 splice site probably benign
R3753:Nfyc UTSW 4 120765330 unclassified probably benign
R5605:Nfyc UTSW 4 120790489 splice site probably benign
R7545:Nfyc UTSW 4 120773769 critical splice acceptor site probably null
R8479:Nfyc UTSW 4 120768892 missense probably damaging 0.97
Z1176:Nfyc UTSW 4 120790487 splice site probably benign
Z1177:Nfyc UTSW 4 120790466 missense unknown
Predicted Primers PCR Primer
(F):5'- TCTATGGAGGTGCACCAAGTAAAG -3'
(R):5'- GGCTTGAACGCTTTATCTGG -3'

Sequencing Primer
(F):5'- AGAGTGTGCTCCATCACTAAGCTG -3'
(R):5'- GTGGTTAACAGTGCAGGCCTAC -3'
Posted On 2018-03-01