Incidental Mutation 'R5982:Rab11fip4'
ID506162
Institutional Source Beutler Lab
Gene Symbol Rab11fip4
Ensembl Gene ENSMUSG00000017639
Gene NameRAB11 family interacting protein 4 (class II)
SynonymsA730072L08Rik, RAB11-FIP4
MMRRC Submission 044163-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5982 (G1)
Quality Score79.0075
Status Validated
Chromosome11
Chromosomal Location79591212-79698023 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79690775 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 532 (N532S)
Ref Sequence ENSEMBL: ENSMUSP00000017783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017783]
Predicted Effect probably benign
Transcript: ENSMUST00000017783
AA Change: N532S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000017783
Gene: ENSMUSG00000017639
AA Change: N532S

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
SCOP:d1mr8a_ 17 90 2e-4 SMART
Blast:EFh 54 81 2e-10 BLAST
low complexity region 247 252 N/A INTRINSIC
low complexity region 388 405 N/A INTRINSIC
Blast:BRLZ 507 574 7e-24 BLAST
Pfam:RBD-FIP 594 634 1.4e-16 PFAM
Meta Mutation Damage Score 0.0765 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with RAB11 and is thought to be involved in bringing recycling endosome membranes to the cleavage furrow in late cytokinesis. Hypoxic conditions can lead to an upregulation of the encoded protein and enhance the metastatic potential of hepatocellular carcinoma. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,953,597 E931D possibly damaging Het
Aebp1 C T 11: 5,867,911 T62I possibly damaging Het
Babam2 A T 5: 31,820,620 E139V possibly damaging Het
Bclaf1 C T 10: 20,323,063 R67* probably null Het
Bcr C A 10: 75,176,416 T51K probably benign Het
Best3 T A 10: 117,004,417 C251S probably damaging Het
Birc6 A G 17: 74,648,158 M3457V probably benign Het
C87436 C A 6: 86,445,975 T177K possibly damaging Het
Cabin1 T A 10: 75,725,560 T1036S probably benign Het
Catsperg2 C A 7: 29,713,017 V383L possibly damaging Het
Ccdc182 C T 11: 88,294,339 Q82* probably null Het
Ccl9 T C 11: 83,575,874 T76A probably damaging Het
Cdc16 G T 8: 13,781,399 C544F possibly damaging Het
Cdh18 A C 15: 23,474,216 D724A possibly damaging Het
Cdip1 G A 16: 4,770,082 P6S probably damaging Het
Col12a1 A G 9: 79,630,560 V2542A probably damaging Het
Dnajc13 G T 9: 104,184,615 T1380K possibly damaging Het
Dsg4 T A 18: 20,465,169 S715T possibly damaging Het
Dync2h1 G T 9: 6,955,986 T4132K probably benign Het
Egfem1 A T 3: 29,657,270 probably null Het
Etl4 G T 2: 20,781,015 V716L probably damaging Het
Exoc3l2 A G 7: 19,480,032 E461G unknown Het
Fam135b A G 15: 71,448,669 probably null Het
Flrt3 G T 2: 140,660,916 P264Q possibly damaging Het
Fmn2 G C 1: 174,502,453 E136D unknown Het
Fosl2 A G 5: 32,146,873 I51V probably benign Het
Foxm1 A G 6: 128,371,035 T307A probably damaging Het
Garem1 T C 18: 21,148,351 D316G possibly damaging Het
Gm13088 C A 4: 143,654,464 V330F probably damaging Het
Gm14403 A T 2: 177,508,552 H97L probably damaging Het
Gm5616 A G 9: 48,450,590 noncoding transcript Het
Hkdc1 T C 10: 62,393,810 D696G probably benign Het
Igkv1-88 C A 6: 68,862,448 W60L probably damaging Het
Iqgap3 G A 3: 88,091,592 W333* probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnk3 G T 5: 30,622,670 V355L probably benign Het
Kmt5c A C 7: 4,746,791 K436T probably damaging Het
Lynx1 T C 15: 74,751,415 Y56C possibly damaging Het
Lypd5 T C 7: 24,353,037 S149P probably damaging Het
Map3k21 A T 8: 125,911,430 N252Y probably damaging Het
Mgat2 T C 12: 69,185,680 W343R probably damaging Het
Misp T G 10: 79,827,894 Y567* probably null Het
Mrgprb1 A T 7: 48,447,820 S115T probably benign Het
Muc16 A C 9: 18,647,146 I2617R unknown Het
Myo19 T A 11: 84,899,400 V394E probably damaging Het
Myo9b T A 8: 71,348,396 L1065Q probably benign Het
Nap1l1 A G 10: 111,495,368 D405G possibly damaging Het
Napb A T 2: 148,700,491 probably null Het
Nbas A G 12: 13,393,430 Y1162C probably benign Het
Nfam1 A T 15: 83,033,124 L36Q probably damaging Het
Nrros T C 16: 32,144,593 D202G probably damaging Het
Olfr1355 T G 10: 78,879,953 Y260* probably null Het
Olfr639 T G 7: 104,011,910 H264P probably damaging Het
Osgin2 T C 4: 15,998,908 E238G probably benign Het
Papss2 A G 19: 32,639,236 T221A probably benign Het
Pcdhga12 A C 18: 37,768,031 K639Q probably damaging Het
Pkhd1l1 T A 15: 44,489,504 probably null Het
Pmepa1 A G 2: 173,234,312 S83P possibly damaging Het
Pnp G A 14: 50,950,543 V118M probably damaging Het
Ppat T C 5: 76,915,265 T500A probably benign Het
Rbm25 A G 12: 83,671,951 D499G probably damaging Het
Rnf139 A G 15: 58,898,838 I237M possibly damaging Het
Rrp15 C T 1: 186,739,755 S85N possibly damaging Het
Sidt1 T C 16: 44,261,708 Y568C probably damaging Het
Slirp A G 12: 87,444,014 T29A probably damaging Het
Sltm G C 9: 70,586,804 E828Q probably damaging Het
Spindoc A G 19: 7,374,595 I129T probably damaging Het
Spire1 T A 18: 67,497,316 probably null Het
Styx A G 14: 45,368,452 T138A probably benign Het
Sv2c A T 13: 95,976,063 L642* probably null Het
Taf7 T C 18: 37,643,445 E23G probably damaging Het
Tcp10a A T 17: 7,345,026 T406S possibly damaging Het
Tnrc6b T A 15: 80,880,816 S840T probably benign Het
Tns3 A G 11: 8,492,245 I706T probably damaging Het
Tpsab1 A G 17: 25,345,372 V36A probably benign Het
Trafd1 T A 5: 121,373,279 D492V probably damaging Het
Trp53 A G 11: 69,587,418 E51G probably benign Het
Vdr C T 15: 97,857,596 A349T probably benign Het
Vmn2r59 T C 7: 42,046,067 D307G probably benign Het
Zfp365 C A 10: 67,897,607 V252F probably damaging Het
Zfp830 T A 11: 82,764,977 N202K probably benign Het
Other mutations in Rab11fip4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Rab11fip4 APN 11 79691879 missense possibly damaging 0.70
IGL01867:Rab11fip4 APN 11 79683390 missense probably benign 0.04
R0013:Rab11fip4 UTSW 11 79689653 missense probably benign 0.27
R0277:Rab11fip4 UTSW 11 79686629 missense possibly damaging 0.82
R0737:Rab11fip4 UTSW 11 79683502 missense probably benign
R4975:Rab11fip4 UTSW 11 79619671 missense probably damaging 1.00
R5382:Rab11fip4 UTSW 11 79690715 missense possibly damaging 0.94
R6086:Rab11fip4 UTSW 11 79683480 missense probably damaging 1.00
R6267:Rab11fip4 UTSW 11 79690829 critical splice donor site probably null
R6296:Rab11fip4 UTSW 11 79690829 critical splice donor site probably null
R7468:Rab11fip4 UTSW 11 79689652 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGCGCATGATGGACAAGCTG -3'
(R):5'- TTGGCGATCAGGTAGCTGAG -3'

Sequencing Primer
(F):5'- AGAACCGCCTGGAGTTCC -3'
(R):5'- CGATCAGGTAGCTGAGAAGAGAC -3'
Posted On2018-03-01