Incidental Mutation 'R6060:1110057P08Rik'
ID506193
Institutional Source Beutler Lab
Gene Symbol 1110057P08Rik
Ensembl Gene ENSMUSG00000068067
Gene NameRIKEN cDNA 1110057P08 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6060 (G1)
Quality Score190.009
Status Validated
Chromosome16
Chromosomal Location89174735-89175199 bp(+) (GRCm38)
Type of Mutationsplice site (94 bp from exon)
DNA Base Change (assembly) A to G at 89169742 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000086499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089097] [ENSMUST00000089098]
Predicted Effect probably benign
Transcript: ENSMUST00000089097
Predicted Effect probably null
Transcript: ENSMUST00000089098
SMART Domains Protein: ENSMUSP00000086499
Gene: ENSMUSG00000068068

DomainStartEndE-ValueType
Pfam:KRTAP 1 46 1.6e-11 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh1 T C 3: 138,286,783 I220T probably damaging Het
Ajap1 G A 4: 153,432,242 T214I probably damaging Het
Ank2 A G 3: 126,955,952 F476S probably damaging Het
Atp6v1g3 A G 1: 138,273,844 K27E possibly damaging Het
B230118H07Rik T C 2: 101,610,605 K18E probably benign Het
BC034090 A G 1: 155,241,499 I291T probably benign Het
Cnot9 T A 1: 74,517,126 N27K probably benign Het
Cyp2c70 A T 19: 40,165,413 L244* probably null Het
Cyp2d22 T C 15: 82,375,885 T6A probably benign Het
D630045J12Rik T C 6: 38,130,864 E1829G probably damaging Het
Dnajc4 G T 19: 6,990,725 S61* probably null Het
Dpysl4 A G 7: 139,089,408 M1V probably null Het
Fam149a T A 8: 45,358,762 probably benign Het
Fam184b T C 5: 45,553,147 E547G probably damaging Het
Fam47e T A 5: 92,579,613 F127I possibly damaging Het
Ifi207 G A 1: 173,730,527 T215I unknown Het
Lpxn T C 19: 12,833,125 L311P probably damaging Het
Lrp1b A T 2: 40,750,934 N3499K Het
Mknk2 A T 10: 80,671,634 D76E probably benign Het
Nectin2 A T 7: 19,717,775 Y445N probably damaging Het
Ngb A C 12: 87,100,189 S85A probably benign Het
Nrp1 C A 8: 128,497,938 H727Q probably damaging Het
Olfr1466 C T 19: 13,342,133 A125V probably benign Het
Olfr420 C A 1: 174,159,341 C189* probably null Het
Pold3 A C 7: 100,100,612 Y115* probably null Het
Ppp1r12b C G 1: 134,955,524 V87L probably benign Het
Ppp1r26 A G 2: 28,451,030 N224S probably benign Het
Prl7a1 G A 13: 27,637,588 P122S probably damaging Het
Rc3h2 T C 2: 37,399,600 H400R possibly damaging Het
Rnf32 A T 5: 29,206,754 I214L probably benign Het
Safb2 A T 17: 56,563,246 probably null Het
Serpinb6e A G 13: 33,841,273 C12R possibly damaging Het
Sh2b2 A T 5: 136,232,355 N2K possibly damaging Het
Slc12a4 G A 8: 105,945,706 A821V probably damaging Het
Slc41a1 A G 1: 131,840,234 M179V probably benign Het
Slc9a3 A G 13: 74,150,885 Y141C probably damaging Het
Tenm4 G A 7: 96,873,711 V1450I probably damaging Het
Trmt1l A G 1: 151,457,580 N642S possibly damaging Het
Ttll13 G A 7: 80,258,743 R576H probably damaging Het
Zar1 T A 5: 72,580,929 R43S probably benign Het
Zfp455 A G 13: 67,207,193 Y175C probably damaging Het
Other mutations in 1110057P08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01503:1110057P08Rik APN 16 89174869 nonsense probably null
IGL02584:1110057P08Rik APN 16 89174856 missense unknown
IGL02822:1110057P08Rik APN 16 89174795 missense unknown
Predicted Primers PCR Primer
(F):5'- CAGAGGATATTATGGAGGCCTG -3'
(R):5'- ACAAGCGCACATTTGTACCC -3'

Sequencing Primer
(F):5'- CCTAGGCTGTGGCTATGGC -3'
(R):5'- GTCACAAACATGCACCTCACATTTAG -3'
Posted On2018-03-08