Incidental Mutation 'R6060:1110057P08Rik'
ID 506193
Institutional Source Beutler Lab
Gene Symbol 1110057P08Rik
Ensembl Gene ENSMUSG00000068067
Gene Name RIKEN cDNA 1110057P08 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock # R6060 (G1)
Quality Score 190.009
Status Validated
Chromosome 16
Chromosomal Location 89174735-89175199 bp(+) (GRCm38)
Type of Mutation splice site (94 bp from exon)
DNA Base Change (assembly) A to G at 89169742 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000086499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089097] [ENSMUST00000089098]
AlphaFold Q3V4B6
Predicted Effect probably benign
Transcript: ENSMUST00000089097
Predicted Effect probably null
Transcript: ENSMUST00000089098
SMART Domains Protein: ENSMUSP00000086499
Gene: ENSMUSG00000068068

DomainStartEndE-ValueType
Pfam:KRTAP 1 46 1.6e-11 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh1 T C 3: 138,286,783 I220T probably damaging Het
Ajap1 G A 4: 153,432,242 T214I probably damaging Het
Ank2 A G 3: 126,955,952 F476S probably damaging Het
Atp6v1g3 A G 1: 138,273,844 K27E possibly damaging Het
B230118H07Rik T C 2: 101,610,605 K18E probably benign Het
BC034090 A G 1: 155,241,499 I291T probably benign Het
Cnot9 T A 1: 74,517,126 N27K probably benign Het
Cyp2c70 A T 19: 40,165,413 L244* probably null Het
Cyp2d22 T C 15: 82,375,885 T6A probably benign Het
D630045J12Rik T C 6: 38,130,864 E1829G probably damaging Het
Dnajc4 G T 19: 6,990,725 S61* probably null Het
Dpysl4 A G 7: 139,089,408 M1V probably null Het
Fam149a T A 8: 45,358,762 probably benign Het
Fam184b T C 5: 45,553,147 E547G probably damaging Het
Fam47e T A 5: 92,579,613 F127I possibly damaging Het
Ifi207 G A 1: 173,730,527 T215I unknown Het
Lpxn T C 19: 12,833,125 L311P probably damaging Het
Lrp1b A T 2: 40,750,934 N3499K Het
Mknk2 A T 10: 80,671,634 D76E probably benign Het
Nectin2 A T 7: 19,717,775 Y445N probably damaging Het
Ngb A C 12: 87,100,189 S85A probably benign Het
Nrp1 C A 8: 128,497,938 H727Q probably damaging Het
Olfr1466 C T 19: 13,342,133 A125V probably benign Het
Olfr420 C A 1: 174,159,341 C189* probably null Het
Pold3 A C 7: 100,100,612 Y115* probably null Het
Ppp1r12b C G 1: 134,955,524 V87L probably benign Het
Ppp1r26 A G 2: 28,451,030 N224S probably benign Het
Prl7a1 G A 13: 27,637,588 P122S probably damaging Het
Rc3h2 T C 2: 37,399,600 H400R possibly damaging Het
Rnf32 A T 5: 29,206,754 I214L probably benign Het
Safb2 A T 17: 56,563,246 probably null Het
Serpinb6e A G 13: 33,841,273 C12R possibly damaging Het
Sh2b2 A T 5: 136,232,355 N2K possibly damaging Het
Slc12a4 G A 8: 105,945,706 A821V probably damaging Het
Slc41a1 A G 1: 131,840,234 M179V probably benign Het
Slc9a3 A G 13: 74,150,885 Y141C probably damaging Het
Tenm4 G A 7: 96,873,711 V1450I probably damaging Het
Trmt1l A G 1: 151,457,580 N642S possibly damaging Het
Ttll13 G A 7: 80,258,743 R576H probably damaging Het
Zar1 T A 5: 72,580,929 R43S probably benign Het
Zfp455 A G 13: 67,207,193 Y175C probably damaging Het
Other mutations in 1110057P08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01503:1110057P08Rik APN 16 89174869 nonsense probably null
IGL02584:1110057P08Rik APN 16 89174856 missense unknown
IGL02822:1110057P08Rik APN 16 89174795 missense unknown
R9199:1110057P08Rik UTSW 16 89174766 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CAGAGGATATTATGGAGGCCTG -3'
(R):5'- ACAAGCGCACATTTGTACCC -3'

Sequencing Primer
(F):5'- CCTAGGCTGTGGCTATGGC -3'
(R):5'- GTCACAAACATGCACCTCACATTTAG -3'
Posted On 2018-03-08