Mutagenetix > Incidental Mutations

Incidental Mutation 'R6127:Mroh2a'

506195

Institutional Source

Beutler Lab

Gene Symbol

Mroh2a

Ensembl Gene

ENSMUSG00000079429

Gene Name

maestro heat-like repeat family member 2A

Synonyms

Heatr7b1, ENSMUSG00000044873, OTTMUSG00000020804

MMRRC Submission

044274-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.921) question?

Stock #

R6127 (G1)

Quality Score

21.0411

Status

Validated

Chromosome

Chromosomal Location

88226986-88262289 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 88234612 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000130508 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061013] [ENSMUST00000113130]

Predicted Effect

probably null
Transcript: ENSMUST00000061013

SMART Domains

Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429

Domain	Start	End	E-Value	Type
low complexity region	9	26	N/A	INTRINSIC
low complexity region	99	112	N/A	INTRINSIC
low complexity region	1235	1248	N/A	INTRINSIC
SCOP:d1jdha_	1371	1669	9e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113130

SMART Domains

Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429

Domain	Start	End	E-Value	Type
low complexity region	9	26	N/A	INTRINSIC
low complexity region	99	112	N/A	INTRINSIC
low complexity region	1232	1245	N/A	INTRINSIC
SCOP:d1gw5a_	1446	1671	6e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142632

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148474

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

98% (49/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HEAT-domain-containing protein. The function of the encoded protein has not been characterized. [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003F12Rik	A	G	2: 154,549,589	E92G	probably damaging	Het
4931429L15Rik	T	A	9: 46,308,922	D104V	probably damaging	Het
Actl9	T	C	17: 33,433,380	V138A	probably benign	Het
Agl	T	A	3: 116,758,329	I1204F	probably damaging	Het
Akna	G	T	4: 63,368,119	T1381N	possibly damaging	Het
Atm	A	C	9: 53,524,509	L167W	probably damaging	Het
Atp2b2	C	T	6: 113,813,877	E189K	probably damaging	Het
Bend7	A	G	2: 4,763,277	D348G	probably damaging	Het
Cactin	G	A	10: 81,324,309	R412H	possibly damaging	Het
Carmil1	T	C	13: 24,036,352	T726A	probably benign	Het
Csmd3	T	A	15: 47,650,228	I2829F	probably damaging	Het
Ddx50	A	T	10: 62,621,563		probably null	Het
Epha5	T	G	5: 84,071,094	K937N	probably damaging	Het
Fblim1	G	A	4: 141,584,722	R231C	probably damaging	Het
Fuca1	T	A	4: 135,934,811	I350N	probably damaging	Het
Hagh	G	T	17: 24,861,004	M152I	probably damaging	Het
Hexdc	T	C	11: 121,216,999	V185A	possibly damaging	Het
Ireb2	A	G	9: 54,882,368	T109A	probably benign	Het
Kcnh2	A	G	5: 24,325,003	Y702H	probably damaging	Het
Leng1	G	A	7: 3,662,867	P157L	probably damaging	Het
Maea	C	T	5: 33,335,518		probably benign	Het
Mertk	G	T	2: 128,738,291	V222F	probably damaging	Het
Muc13	G	A	16: 33,798,947	A22T	unknown	Het
Muc16	T	A	9: 18,657,878	H1115L	unknown	Het
Olfr1156	T	A	2: 87,949,361	S291C	probably damaging	Het
Olfr1389	C	A	11: 49,430,806	T110K	probably damaging	Het
Olfr291	T	A	7: 84,857,202	L278M	probably damaging	Het
Olfr816	A	G	10: 129,911,415	Y288H	probably damaging	Het
Pak7	G	A	2: 136,087,406	P619L	probably damaging	Het
Pcdh17	A	G	14: 84,533,060	K993E	probably damaging	Het
Pcdhga3	A	T	18: 37,674,704	Q70L	probably damaging	Het
Pcdhgb5	C	A	18: 37,732,879	R576S	probably damaging	Het
Pold1	T	C	7: 44,542,121	Y147C	probably damaging	Het
Prag1	T	C	8: 36,147,401	L1369P	unknown	Het
Psg29	T	A	7: 17,211,746	F414I	probably benign	Het
Robo1	A	T	16: 73,013,068	M1235L	probably benign	Het
Rp1	C	A	1: 4,349,311	S526I	possibly damaging	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Setd7	G	A	3: 51,530,081	T251I	probably damaging	Het
Slc25a41	T	A	17: 57,034,914	Y145F	probably damaging	Het
Stag1	T	C	9: 100,951,697	V1121A	probably benign	Het
Svip	T	C	7: 52,003,453	T38A	probably benign	Het
Tacc2	A	T	7: 130,626,115	H1510L	possibly damaging	Het
Trav19	A	G	14: 53,845,542	T25A	probably benign	Het
Trip4	A	T	9: 65,866,470		probably null	Het
Tulp1	T	A	17: 28,356,150	H447L	probably benign	Het
Vmn1r200	A	T	13: 22,395,203	T59S	probably benign	Het
Vmn2r51	A	T	7: 10,105,631	L10H	probably damaging	Het
Wee2	T	C	6: 40,449,767	Y157H	probably damaging	Het
Xrn1	T	C	9: 95,969,489	S187P	probably damaging	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het

Other mutations in Mroh2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Mroh2a	APN	1	88230746	missense	probably damaging	0.99
IGL00990:Mroh2a	APN	1	88244970	missense	probably benign	0.03
IGL00990:Mroh2a	APN	1	88234120	missense	possibly damaging	0.76
IGL03097:Mroh2a	UTSW	1	88235376	missense	probably benign	0.30
R0032:Mroh2a	UTSW	1	88256166	frame shift	probably null
R0068:Mroh2a	UTSW	1	88256166	frame shift	probably null
R0139:Mroh2a	UTSW	1	88257802	missense	probably damaging	1.00
R0197:Mroh2a	UTSW	1	88246042	missense	probably damaging	1.00
R0242:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R0322:Mroh2a	UTSW	1	88230680	nonsense	probably null
R0374:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R0387:Mroh2a	UTSW	1	88246042	missense	probably damaging	1.00
R0412:Mroh2a	UTSW	1	88235216	missense	probably benign	0.01
R0536:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R0548:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R0580:Mroh2a	UTSW	1	88243950	missense	probably damaging	1.00
R0581:Mroh2a	UTSW	1	88256166	frame shift	probably null
R0583:Mroh2a	UTSW	1	88256166	frame shift	probably null
R0613:Mroh2a	UTSW	1	88243950	missense	probably damaging	1.00
R0652:Mroh2a	UTSW	1	88230680	nonsense	probably null
R0657:Mroh2a	UTSW	1	88255565	missense	probably damaging	1.00
R0659:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R0659:Mroh2a	UTSW	1	88250342	missense	probably damaging	1.00
R0671:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R0675:Mroh2a	UTSW	1	88228380	missense	probably damaging	0.99
R0675:Mroh2a	UTSW	1	88250342	missense	probably damaging	1.00
R0689:Mroh2a	UTSW	1	88230680	nonsense	probably null
R0689:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R0735:Mroh2a	UTSW	1	88243950	missense	probably damaging	1.00
R0761:Mroh2a	UTSW	1	88243950	missense	probably damaging	1.00
R0766:Mroh2a	UTSW	1	88230680	nonsense	probably null
R0845:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R0853:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R0959:Mroh2a	UTSW	1	88232257	frame shift	probably null
R0960:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R1004:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R1013:Mroh2a	UTSW	1	88234612	critical splice donor site	probably null
R1028:Mroh2a	UTSW	1	88235376	missense	probably benign	0.30
R1268:Mroh2a	UTSW	1	88230680	nonsense	probably null
R1281:Mroh2a	UTSW	1	88256167	frame shift	probably null
R1414:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R1439:Mroh2a	UTSW	1	88257802	missense	probably damaging	1.00
R1441:Mroh2a	UTSW	1	88241631	missense	possibly damaging	0.93
R1442:Mroh2a	UTSW	1	88232353	splice site	probably benign
R1442:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R1465:Mroh2a	UTSW	1	88257802	missense	probably damaging	1.00
R1662:Mroh2a	UTSW	1	88241618	missense	probably benign	0.07
R1686:Mroh2a	UTSW	1	88230680	nonsense	probably null
R1686:Mroh2a	UTSW	1	88234612	critical splice donor site	probably null
R1780:Mroh2a	UTSW	1	88230680	nonsense	probably null
R1846:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R1899:Mroh2a	UTSW	1	88235376	missense	probably benign	0.30
R1958:Mroh2a	UTSW	1	88237491	nonsense	probably null
R2122:Mroh2a	UTSW	1	88256754	missense	probably benign	0.37
R2248:Mroh2a	UTSW	1	88256754	missense	probably benign	0.37
R2306:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R2869:Mroh2a	UTSW	1	88232257	frame shift	probably null
R2870:Mroh2a	UTSW	1	88232257	frame shift	probably null
R2871:Mroh2a	UTSW	1	88255565	missense	probably damaging	1.00
R2872:Mroh2a	UTSW	1	88232257	frame shift	probably null
R3408:Mroh2a	UTSW	1	88232257	frame shift	probably null
R3608:Mroh2a	UTSW	1	88244995	missense	probably damaging	1.00
R3730:Mroh2a	UTSW	1	88232257	frame shift	probably null
R3937:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R4022:Mroh2a	UTSW	1	88246042	missense	probably damaging	1.00
R4049:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R4133:Mroh2a	UTSW	1	88254965	missense	possibly damaging	0.95
R4361:Mroh2a	UTSW	1	88254965	missense	possibly damaging	0.95
R4392:Mroh2a	UTSW	1	88259589	missense	probably damaging	1.00
R4401:Mroh2a	UTSW	1	88254935	missense	possibly damaging	0.72
R4402:Mroh2a	UTSW	1	88254935	missense	possibly damaging	0.72
R4575:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R4625:Mroh2a	UTSW	1	88254965	missense	possibly damaging	0.95
R4631:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R4665:Mroh2a	UTSW	1	88241618	missense	probably benign	0.07
R4701:Mroh2a	UTSW	1	88234612	critical splice donor site	probably null
R4701:Mroh2a	UTSW	1	88241618	missense	probably benign	0.07
R4771:Mroh2a	UTSW	1	88251365	missense	probably damaging	1.00
R4795:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R4839:Mroh2a	UTSW	1	88237944	missense	probably damaging	1.00
R4873:Mroh2a	UTSW	1	88254935	missense	possibly damaging	0.72
R4875:Mroh2a	UTSW	1	88254935	missense	possibly damaging	0.72
R4896:Mroh2a	UTSW	1	88256754	missense	probably benign	0.37
R5007:Mroh2a	UTSW	1	88232257	frame shift	probably null
R5031:Mroh2a	UTSW	1	88232257	frame shift	probably null
R5062:Mroh2a	UTSW	1	88232257	frame shift	probably null
R5301:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R5367:Mroh2a	UTSW	1	88254965	missense	possibly damaging	0.95
R5371:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R5446:Mroh2a	UTSW	1	88254965	missense	possibly damaging	0.95
R5484:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R5506:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R5561:Mroh2a	UTSW	1	88232257	frame shift	probably null
R5615:Mroh2a	UTSW	1	88232257	frame shift	probably null
R5825:Mroh2a	UTSW	1	88230680	nonsense	probably null
R5891:Mroh2a	UTSW	1	88241615	missense	possibly damaging	0.93
R5906:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R5928:Mroh2a	UTSW	1	88241618	missense	probably benign	0.07
R6004:Mroh2a	UTSW	1	88248655	missense	probably damaging	1.00
R6035:Mroh2a	UTSW	1	88230668	missense	probably damaging	1.00
R6064:Mroh2a	UTSW	1	88232257	frame shift	probably null
R6074:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R6091:Mroh2a	UTSW	1	88232257	frame shift	probably null
R6234:Mroh2a	UTSW	1	88234612	critical splice donor site	probably null
R6234:Mroh2a	UTSW	1	88256754	missense	probably benign	0.37
R6244:Mroh2a	UTSW	1	88256754	missense	probably benign	0.37
R6464:Mroh2a	UTSW	1	88257802	missense	probably damaging	1.00
R6465:Mroh2a	UTSW	1	88232257	frame shift	probably null
R6575:Mroh2a	UTSW	1	88232257	frame shift	probably null
R6809:Mroh2a	UTSW	1	88235216	missense	probably benign	0.01
R6819:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R6854:Mroh2a	UTSW	1	88243950	missense	probably damaging	1.00
R6860:Mroh2a	UTSW	1	88254935	missense	possibly damaging	0.72
R7126:Mroh2a	UTSW	1	88254935	missense	possibly damaging	0.72
R7818:Mroh2a	UTSW	1	88234612	critical splice donor site	probably null
RF024:Mroh2a	UTSW	1	88242485	missense	probably damaging	1.00
V5622:Mroh2a	UTSW	1	88227091	start gained	probably benign
V8831:Mroh2a	UTSW	1	88256167	frame shift	probably null
X0027:Mroh2a	UTSW	1	88248613	missense	possibly damaging	0.86
X0028:Mroh2a	UTSW	1	88232257	frame shift	probably null
X0028:Mroh2a	UTSW	1	88256166	frame shift	probably null
X0033:Mroh2a	UTSW	1	88256166	frame shift	probably null
X0034:Mroh2a	UTSW	1	88232257	frame shift	probably null
X0034:Mroh2a	UTSW	1	88232292	missense	probably damaging	1.00
X0034:Mroh2a	UTSW	1	88256166	frame shift	probably null
X0039:Mroh2a	UTSW	1	88232257	frame shift	probably null
X0057:Mroh2a	UTSW	1	88232257	frame shift	probably null
X0057:Mroh2a	UTSW	1	88255655	missense	probably benign	0.25
X0057:Mroh2a	UTSW	1	88256166	frame shift	probably null
X0063:Mroh2a	UTSW	1	88232257	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TCACTGTAACTAAGAACCATGGG -3'
(R):5'- TCCCTGGATGACTTGTGTGC -3'

Sequencing Primer
(F):5'- GGACCCTTGAGCAGTTATACC -3'
(R):5'- CCTGATAAACTTGGAGAGTGTGC -3'

Posted On

2018-03-08