Incidental Mutation 'R5841:Rhbdf2'
ID506199
Institutional Source Beutler Lab
Gene Symbol Rhbdf2
Ensembl Gene ENSMUSG00000020806
Gene Namerhomboid 5 homolog 2
SynonymsiRhom2, Rhbdl6, 4732465I17Rik
MMRRC Submission 044061-MU
Accession Numbers

VEGA: OTTMUST00000008766; MGI: 2442473

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5841 (G1)
Quality Score70
Status Validated
Chromosome11
Chromosomal Location116598165-116627019 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 116602354 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021160] [ENSMUST00000103028] [ENSMUST00000103029] [ENSMUST00000123507] [ENSMUST00000153476]
Predicted Effect probably benign
Transcript: ENSMUST00000021160
SMART Domains Protein: ENSMUSP00000021160
Gene: ENSMUSG00000020804

DomainStartEndE-ValueType
PDB:1KUY|A 3 104 1e-50 PDB
SCOP:d1cjwa_ 28 103 4e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103028
SMART Domains Protein: ENSMUSP00000099317
Gene: ENSMUSG00000020806

DomainStartEndE-ValueType
Pfam:Rhomboid_SP 98 306 1.8e-98 PFAM
transmembrane domain 376 398 N/A INTRINSIC
Pfam:Rhomboid 619 763 4.6e-31 PFAM
transmembrane domain 775 797 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103029
SMART Domains Protein: ENSMUSP00000099318
Gene: ENSMUSG00000020806

DomainStartEndE-ValueType
Pfam:Rhomboid_SP 98 304 4.7e-97 PFAM
transmembrane domain 376 398 N/A INTRINSIC
Pfam:Rhomboid 619 763 8.1e-31 PFAM
transmembrane domain 775 797 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123507
SMART Domains Protein: ENSMUSP00000115999
Gene: ENSMUSG00000020804

DomainStartEndE-ValueType
PDB:1IB1|H 3 53 6e-16 PDB
SCOP:d1cjwa_ 28 59 1e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138125
Predicted Effect probably benign
Transcript: ENSMUST00000153476
SMART Domains Protein: ENSMUSP00000122895
Gene: ENSMUSG00000020804

DomainStartEndE-ValueType
Pfam:Acetyltransf_1 82 172 4.1e-14 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (67/67)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display impaired TNF secretion and increased sensitivity to bacterial infection induced mortality. [provided by MGI curators]
Allele List at MGI

All alleles(34) : Targeted(4) Gene trapped(30)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A T 1: 75,174,350 F565L possibly damaging Het
Abhd6 T A 14: 8,049,596 V188D probably benign Het
Bbs12 T G 3: 37,319,521 N39K probably benign Het
Bend5 A G 4: 111,433,470 Y221C probably damaging Het
Brd8 A G 18: 34,605,523 S683P probably damaging Het
Caskin1 A G 17: 24,496,209 D79G probably damaging Het
Cdyl T C 13: 35,872,561 L509P probably damaging Het
Cenpf G T 1: 189,657,444 T1397N possibly damaging Het
Ckap5 T A 2: 91,600,682 M1479K probably benign Het
Cpsf2 T C 12: 101,985,238 S145P probably damaging Het
Cyp4a12a A T 4: 115,326,702 H235L probably benign Het
Cyp7b1 A T 3: 18,097,506 F181Y probably damaging Het
Dennd5b T C 6: 149,044,755 T453A probably benign Het
Dlgap3 A G 4: 127,195,400 D263G probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Dync2li1 G A 17: 84,633,562 G69R probably damaging Het
Edc3 T C 9: 57,744,602 V331A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ganc C T 2: 120,411,539 T66I possibly damaging Het
Gm11595 C A 11: 99,772,317 C179F unknown Het
Gm13088 A G 4: 143,655,539 S196P possibly damaging Het
Gm15448 T A 7: 3,822,899 R324* probably null Het
Gnptg A G 17: 25,235,417 S159P probably damaging Het
Gsdmc2 C T 15: 63,826,210 V349I probably benign Het
Hydin T C 8: 110,533,214 I2606T possibly damaging Het
Ino80d A G 1: 63,058,840 S632P probably damaging Het
Kcnn2 G A 18: 45,559,396 R13H probably benign Het
Klb A T 5: 65,379,324 K666* probably null Het
Kmt2d G A 15: 98,852,109 probably benign Het
Kpna7 T C 5: 144,993,956 I360V possibly damaging Het
Lmbrd2 A G 15: 9,182,570 K576E possibly damaging Het
Lrp2 T A 2: 69,480,153 Y2692F probably benign Het
Meis2 T A 2: 116,058,664 E202D probably benign Het
Mgat4c A T 10: 102,388,965 T347S probably damaging Het
Mmp12 G A 9: 7,347,501 C26Y possibly damaging Het
Mrpl24 G A 3: 87,922,985 R145Q probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Mycbpap T A 11: 94,505,610 R135W probably damaging Het
Myo1g T A 11: 6,507,000 Y942F probably benign Het
Myrf T C 19: 10,223,547 K52R probably null Het
Ncf2 A T 1: 152,821,518 silent Het
Olfr585 T C 7: 103,097,954 F71S probably damaging Het
Otx1 T C 11: 21,998,594 probably benign Het
Pcnx T A 12: 81,918,655 V532D possibly damaging Het
Pik3r5 T C 11: 68,492,270 L305P probably damaging Het
Polr3a A T 14: 24,450,698 C1341S probably benign Het
Ppp1r3a T C 6: 14,718,984 T644A probably benign Het
Ptbp1 A G 10: 79,859,932 D289G probably benign Het
Pwp2 A G 10: 78,172,118 F868L probably benign Het
Rgs8 A G 1: 153,692,828 E153G probably damaging Het
Sbf1 T C 15: 89,308,068 H78R probably damaging Het
Sdr16c6 C T 4: 4,062,728 A197T possibly damaging Het
Slc36a3 A T 11: 55,125,721 Y349* probably null Het
Slc38a9 T C 13: 112,695,322 L202P possibly damaging Het
Slc40a1 A T 1: 45,912,349 M216K probably damaging Het
Slc9a3r2 A T 17: 24,644,877 M8K probably benign Het
Srebf1 T A 11: 60,203,584 Q568H possibly damaging Het
Srp54b A G 12: 55,252,829 N315S probably benign Het
Strc A G 2: 121,365,877 F1557L probably benign Het
Susd3 C A 13: 49,238,726 probably benign Het
Usp54 G A 14: 20,550,283 T1462I probably benign Het
Vmn1r11 T A 6: 57,137,802 N150K probably damaging Het
Vwa8 C T 14: 78,994,518 H606Y probably benign Het
Zmym6 A G 4: 127,100,670 I206V possibly damaging Het
Other mutations in Rhbdf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Rhbdf2 APN 11 116601751 missense possibly damaging 0.80
IGL01464:Rhbdf2 APN 11 116600908 missense probably benign 0.18
IGL02060:Rhbdf2 APN 11 116600626 missense probably damaging 1.00
IGL02211:Rhbdf2 APN 11 116600435 missense possibly damaging 0.49
Lostnf UTSW 11 116600161 missense probably damaging 1.00
Lostnf2 UTSW 11 116600191 missense possibly damaging 0.94
sinecure UTSW 11 116602260 missense probably damaging 0.99
Trapezoid UTSW 11 116601148 missense probably damaging 0.96
R0131:Rhbdf2 UTSW 11 116605344 missense probably damaging 1.00
R0399:Rhbdf2 UTSW 11 116603992 missense probably benign 0.00
R0739:Rhbdf2 UTSW 11 116600161 missense probably damaging 1.00
R1756:Rhbdf2 UTSW 11 116607266 missense probably benign
R1839:Rhbdf2 UTSW 11 116600191 missense possibly damaging 0.94
R2029:Rhbdf2 UTSW 11 116601148 missense probably damaging 0.96
R3833:Rhbdf2 UTSW 11 116604424 missense probably damaging 1.00
R4330:Rhbdf2 UTSW 11 116601956 missense probably benign
R4331:Rhbdf2 UTSW 11 116602296 missense probably damaging 1.00
R4872:Rhbdf2 UTSW 11 116601945 missense probably benign 0.04
R5530:Rhbdf2 UTSW 11 116600662 missense probably damaging 1.00
R5625:Rhbdf2 UTSW 11 116605377 missense probably damaging 0.99
R6579:Rhbdf2 UTSW 11 116604463 missense probably benign 0.02
R7047:Rhbdf2 UTSW 11 116603651 critical splice donor site probably null
R7403:Rhbdf2 UTSW 11 116600419 missense probably damaging 1.00
R7743:Rhbdf2 UTSW 11 116601601 missense probably benign 0.04
R7743:Rhbdf2 UTSW 11 116603949 missense probably benign
R7855:Rhbdf2 UTSW 11 116602240 nonsense probably null
R8055:Rhbdf2 UTSW 11 116607365 missense probably benign 0.01
R8700:Rhbdf2 UTSW 11 116607404 start gained probably benign
X0027:Rhbdf2 UTSW 11 116599093 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACTGTGCCAAAGCTCCTTGG -3'
(R):5'- CAATTGCAGGTGAGCACAGG -3'

Sequencing Primer
(F):5'- GAGGAACCCTACTCACCAGCTG -3'
(R):5'- GCAGGCTTGCCAGTTATCAG -3'
Posted On2018-03-08