Incidental Mutation 'R6251:Olfr382'
ID506238
Institutional Source Beutler Lab
Gene Symbol Olfr382
Ensembl Gene ENSMUSG00000095312
Gene Nameolfactory receptor 382
SynonymsMOR135-31_p, MOR135-14, GA_x6K02T2P1NL-3676608-3675670
MMRRC Submission 044368-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R6251 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location73516259-73517197 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73516708 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 164 (S164P)
Ref Sequence ENSEMBL: ENSMUSP00000091575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092921]
Predicted Effect probably benign
Transcript: ENSMUST00000092921
AA Change: S164P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000091575
Gene: ENSMUSG00000095312
AA Change: S164P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.6e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.9e-10 PFAM
Pfam:7tm_1 41 290 1.2e-24 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3100002H09Rik A G 4: 124,610,652 S36P probably damaging Het
AF067061 T C 13: 120,263,371 probably benign Het
Agmo A G 12: 37,252,539 D125G probably damaging Het
Arhgap26 A T 18: 39,357,827 S328C probably null Het
Arl6 T C 16: 59,618,806 D175G probably damaging Het
Asb3 G A 11: 31,055,559 A192T probably damaging Het
Atp10b A T 11: 43,235,746 M1110L possibly damaging Het
Cacna1i T C 15: 80,336,682 I175T probably damaging Het
Car15 A T 16: 17,837,363 I71N probably benign Het
Casq1 T A 1: 172,216,840 Y140F probably benign Het
Ccdc93 C T 1: 121,434,540 T17M possibly damaging Het
Cfap46 CCTTCTTCT CCTTCT 7: 139,638,900 probably benign Het
Ciart G A 3: 95,881,011 probably benign Het
Cul5 A T 9: 53,646,794 V170D probably benign Het
Cyb5r3 T C 15: 83,154,716 D224G probably benign Het
Daam1 G A 12: 71,988,949 G964R probably damaging Het
Daglb T A 5: 143,489,934 L383Q probably damaging Het
Dazap2 T G 15: 100,616,983 H28Q possibly damaging Het
Dnttip2 A T 3: 122,275,256 D40V probably benign Het
Epn1 G T 7: 5,095,926 D406Y probably damaging Het
Epn1 G T 7: 5,095,936 R409L probably damaging Het
Evc T C 5: 37,300,499 T966A probably benign Het
Extl3 T C 14: 65,076,926 D269G probably damaging Het
Gfra3 TGCGC TGC 18: 34,695,811 probably null Het
Gm4778 G T 3: 94,265,901 S72I probably damaging Het
Gpr87 A T 3: 59,179,107 F326I probably damaging Het
Hivep3 C A 4: 120,094,940 P151H probably damaging Het
Kcnj14 T A 7: 45,818,016 E302V probably damaging Het
Kdm5d T C Y: 921,693 Y534H probably damaging Homo
Map3k5 T A 10: 20,138,260 probably null Het
Marc1 G A 1: 184,795,451 R271W probably damaging Het
Mdn1 A G 4: 32,748,590 T4212A probably benign Het
Ms4a6d A T 19: 11,587,140 S122R probably damaging Het
Nectin3 A T 16: 46,395,150 H76Q probably damaging Het
Notch1 C A 2: 26,474,170 E846D possibly damaging Het
Olfr1200 T C 2: 88,768,288 E9G probably damaging Het
Olfr1537 T A 9: 39,238,218 I72F possibly damaging Het
Olfr883 G GGGATTGC 9: 38,026,537 probably null Het
Olfr883 TGTTT TGTTTGCAGTTT 9: 38,026,545 probably null Het
Olfr883 GTTT GTTTGCTTTTT 9: 38,026,546 probably null Het
Olfr883 TT TTGCTGTGT 9: 38,026,548 probably null Het
Pfkl C T 10: 77,989,565 probably null Het
Pigz T C 16: 31,945,606 V494A possibly damaging Het
Pik3r4 T C 9: 105,654,048 V516A probably benign Het
Polr2b G A 5: 77,348,294 R1104K probably benign Het
Rap1a A T 3: 105,731,995 L116* probably null Het
Rnf114 T C 2: 167,514,729 *230R probably null Het
Rtl1 G T 12: 109,593,649 N585K probably benign Het
Serpinb5 G T 1: 106,875,065 R110I possibly damaging Het
Spink6 T C 18: 44,074,431 probably null Het
Stk39 A T 2: 68,307,039 probably null Het
Tcte1 A T 17: 45,535,159 T230S probably benign Het
Tctex1d2 T A 16: 32,426,909 D125E possibly damaging Het
Tecpr1 C A 5: 144,198,576 V1020L probably damaging Het
Tmc7 T C 7: 118,561,038 Y192C possibly damaging Het
Trim63 A T 4: 134,323,226 T274S probably benign Het
Wdr43 G A 17: 71,650,053 probably null Het
Zfr T C 15: 12,160,591 I750T probably benign Het
Other mutations in Olfr382
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Olfr382 APN 11 73516410 missense possibly damaging 0.59
IGL00896:Olfr382 APN 11 73516341 missense probably damaging 1.00
IGL01723:Olfr382 APN 11 73516626 missense probably damaging 1.00
IGL01734:Olfr382 APN 11 73516636 missense probably benign 0.39
IGL02267:Olfr382 APN 11 73516549 missense probably benign 0.44
IGL02681:Olfr382 APN 11 73516530 missense probably benign
IGL03165:Olfr382 APN 11 73516884 nonsense probably null
BB009:Olfr382 UTSW 11 73517157 missense probably damaging 1.00
BB019:Olfr382 UTSW 11 73517157 missense probably damaging 1.00
IGL03134:Olfr382 UTSW 11 73517115 missense probably benign 0.02
R0320:Olfr382 UTSW 11 73516924 missense probably damaging 1.00
R0633:Olfr382 UTSW 11 73516927 missense probably benign 0.23
R0638:Olfr382 UTSW 11 73516924 missense probably damaging 1.00
R0691:Olfr382 UTSW 11 73516844 missense possibly damaging 0.55
R1630:Olfr382 UTSW 11 73516720 missense probably damaging 1.00
R2269:Olfr382 UTSW 11 73516483 missense probably damaging 1.00
R4001:Olfr382 UTSW 11 73516986 missense probably damaging 1.00
R4925:Olfr382 UTSW 11 73517172 missense possibly damaging 0.87
R5707:Olfr382 UTSW 11 73516625 missense probably damaging 1.00
R5911:Olfr382 UTSW 11 73516525 missense probably damaging 1.00
R6225:Olfr382 UTSW 11 73517005 missense probably damaging 0.99
R6332:Olfr382 UTSW 11 73517175 missense probably benign 0.00
R7013:Olfr382 UTSW 11 73516421 nonsense probably null
R7196:Olfr382 UTSW 11 73517131 missense probably benign
R7443:Olfr382 UTSW 11 73516848 missense possibly damaging 0.89
R7932:Olfr382 UTSW 11 73517157 missense probably damaging 1.00
R8201:Olfr382 UTSW 11 73517073 missense probably damaging 1.00
R8257:Olfr382 UTSW 11 73516377 missense probably benign 0.28
R8547:Olfr382 UTSW 11 73516614 missense probably damaging 1.00
Z1177:Olfr382 UTSW 11 73517035 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCATAGAACAGTGAGACTACAG -3'
(R):5'- TTTTGGAGACCTGGAGAGCATC -3'

Sequencing Primer
(F):5'- ACTACAGACAGGTGGGACCC -3'
(R):5'- AGAGCATCCTTCTTTTGGTCATG -3'
Posted On2018-03-15