Incidental Mutation 'R6251:Agmo'
ID506239
Institutional Source Beutler Lab
Gene Symbol Agmo
Ensembl Gene ENSMUSG00000050103
Gene Namealkylglycerol monooxygenase
SynonymsA530016O06Rik, Tmem195
MMRRC Submission 044368-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R6251 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location37241641-37582202 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37252539 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 125 (D125G)
Ref Sequence ENSEMBL: ENSMUSP00000125639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049874] [ENSMUST00000159998] [ENSMUST00000160390]
Predicted Effect probably damaging
Transcript: ENSMUST00000049874
AA Change: D125G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051441
Gene: ENSMUSG00000050103
AA Change: D125G

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
Pfam:FA_hydroxylase 117 249 2.5e-29 PFAM
transmembrane domain 364 383 N/A INTRINSIC
transmembrane domain 411 433 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159998
AA Change: D125G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123801
Gene: ENSMUSG00000050103
AA Change: D125G

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
Pfam:FA_hydroxylase 117 226 7e-21 PFAM
transmembrane domain 364 383 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160158
Predicted Effect probably damaging
Transcript: ENSMUST00000160390
AA Change: D125G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125639
Gene: ENSMUSG00000050103
AA Change: D125G

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
Pfam:FA_hydroxylase 117 226 7.1e-21 PFAM
transmembrane domain 364 383 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tetrahydrobiopterin- and iron-dependent enzyme that cleaves the ether bond of alkylglycerols. Sequence comparisons distinguish this protein as forming a third, distinct class of tetrahydrobiopterin-dependent enzymes. Variations in this gene have been associated with decreased glucose-stimulated insulin response, type 2 diabetes, and susceptibility to intracranial aneurysms. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3100002H09Rik A G 4: 124,610,652 S36P probably damaging Het
AF067061 T C 13: 120,263,371 probably benign Het
Arhgap26 A T 18: 39,357,827 S328C probably null Het
Arl6 T C 16: 59,618,806 D175G probably damaging Het
Asb3 G A 11: 31,055,559 A192T probably damaging Het
Atp10b A T 11: 43,235,746 M1110L possibly damaging Het
Cacna1i T C 15: 80,336,682 I175T probably damaging Het
Car15 A T 16: 17,837,363 I71N probably benign Het
Casq1 T A 1: 172,216,840 Y140F probably benign Het
Ccdc93 C T 1: 121,434,540 T17M possibly damaging Het
Cfap46 CCTTCTTCT CCTTCT 7: 139,638,900 probably benign Het
Ciart G A 3: 95,881,011 probably benign Het
Cul5 A T 9: 53,646,794 V170D probably benign Het
Cyb5r3 T C 15: 83,154,716 D224G probably benign Het
Daam1 G A 12: 71,988,949 G964R probably damaging Het
Daglb T A 5: 143,489,934 L383Q probably damaging Het
Dazap2 T G 15: 100,616,983 H28Q possibly damaging Het
Dnttip2 A T 3: 122,275,256 D40V probably benign Het
Epn1 G T 7: 5,095,926 D406Y probably damaging Het
Epn1 G T 7: 5,095,936 R409L probably damaging Het
Evc T C 5: 37,300,499 T966A probably benign Het
Extl3 T C 14: 65,076,926 D269G probably damaging Het
Gfra3 TGCGC TGC 18: 34,695,811 probably null Het
Gm4778 G T 3: 94,265,901 S72I probably damaging Het
Gpr87 A T 3: 59,179,107 F326I probably damaging Het
Hivep3 C A 4: 120,094,940 P151H probably damaging Het
Kcnj14 T A 7: 45,818,016 E302V probably damaging Het
Kdm5d T C Y: 921,693 Y534H probably damaging Homo
Map3k5 T A 10: 20,138,260 probably null Het
Marc1 G A 1: 184,795,451 R271W probably damaging Het
Mdn1 A G 4: 32,748,590 T4212A probably benign Het
Ms4a6d A T 19: 11,587,140 S122R probably damaging Het
Nectin3 A T 16: 46,395,150 H76Q probably damaging Het
Notch1 C A 2: 26,474,170 E846D possibly damaging Het
Olfr1200 T C 2: 88,768,288 E9G probably damaging Het
Olfr1537 T A 9: 39,238,218 I72F possibly damaging Het
Olfr382 A G 11: 73,516,708 S164P probably benign Het
Olfr883 G GGGATTGC 9: 38,026,537 probably null Het
Olfr883 TGTTT TGTTTGCAGTTT 9: 38,026,545 probably null Het
Olfr883 GTTT GTTTGCTTTTT 9: 38,026,546 probably null Het
Olfr883 TT TTGCTGTGT 9: 38,026,548 probably null Het
Pfkl C T 10: 77,989,565 probably null Het
Pigz T C 16: 31,945,606 V494A possibly damaging Het
Pik3r4 T C 9: 105,654,048 V516A probably benign Het
Polr2b G A 5: 77,348,294 R1104K probably benign Het
Rap1a A T 3: 105,731,995 L116* probably null Het
Rnf114 T C 2: 167,514,729 *230R probably null Het
Rtl1 G T 12: 109,593,649 N585K probably benign Het
Serpinb5 G T 1: 106,875,065 R110I possibly damaging Het
Spink6 T C 18: 44,074,431 probably null Het
Stk39 A T 2: 68,307,039 probably null Het
Tcte1 A T 17: 45,535,159 T230S probably benign Het
Tctex1d2 T A 16: 32,426,909 D125E possibly damaging Het
Tecpr1 C A 5: 144,198,576 V1020L probably damaging Het
Tmc7 T C 7: 118,561,038 Y192C possibly damaging Het
Trim63 A T 4: 134,323,226 T274S probably benign Het
Wdr43 G A 17: 71,650,053 probably null Het
Zfr T C 15: 12,160,591 I750T probably benign Het
Other mutations in Agmo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Agmo APN 12 37357717 missense probably damaging 1.00
IGL01412:Agmo APN 12 37402141 missense possibly damaging 0.49
IGL01682:Agmo APN 12 37357627 splice site probably benign
IGL02263:Agmo APN 12 37357697 missense probably damaging 1.00
IGL02478:Agmo APN 12 37401986 missense probably damaging 1.00
IGL02803:Agmo APN 12 37252481 missense probably benign 0.00
R0664:Agmo UTSW 12 37252572 missense probably damaging 1.00
R2158:Agmo UTSW 12 37357710 missense probably damaging 1.00
R3440:Agmo UTSW 12 37243800 missense probably damaging 1.00
R5263:Agmo UTSW 12 37357681 missense probably benign 0.01
R6249:Agmo UTSW 12 37243838 critical splice donor site probably null
R7513:Agmo UTSW 12 37244353 missense probably benign 0.01
R7686:Agmo UTSW 12 37419974 missense probably benign 0.00
R7729:Agmo UTSW 12 37414975 missense probably benign 0.00
R7731:Agmo UTSW 12 37414940 missense probably benign 0.01
R7849:Agmo UTSW 12 37242045 missense probably benign 0.03
R7852:Agmo UTSW 12 37242052 missense possibly damaging 0.92
R7932:Agmo UTSW 12 37242045 missense probably benign 0.03
R7935:Agmo UTSW 12 37242052 missense possibly damaging 0.92
R8071:Agmo UTSW 12 37398729 missense probably damaging 1.00
R8089:Agmo UTSW 12 37347307 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CATACTAAACATCACCTTGGCTG -3'
(R):5'- TGCTCCAGAATGACCTGTGATG -3'

Sequencing Primer
(F):5'- AACATCACCTTGGCTGTTATATTG -3'
(R):5'- CTCCAGAATGACCTGTGATGATTGG -3'
Posted On2018-03-15