Incidental Mutation 'R6251:Daam1'
ID 506240
Institutional Source Beutler Lab
Gene Symbol Daam1
Ensembl Gene ENSMUSG00000034574
Gene Name dishevelled associated activator of morphogenesis 1
Synonyms 1700066F09Rik, 2310028E21Rik
MMRRC Submission 044368-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6251 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 71831078-71992333 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 71988949 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 964 (G964R)
Ref Sequence ENSEMBL: ENSMUSP00000152532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085299] [ENSMUST00000221317] [ENSMUST00000223272]
AlphaFold Q8BPM0
Predicted Effect probably damaging
Transcript: ENSMUST00000085299
AA Change: G973R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000082406
Gene: ENSMUSG00000034574
AA Change: G973R

DomainStartEndE-ValueType
Drf_GBD 45 232 4.99e-67 SMART
Drf_FH3 235 433 1.92e-77 SMART
SCOP:d1eq1a_ 442 522 4e-3 SMART
Blast:Drf_FH3 459 519 1e-9 BLAST
SCOP:d1jvr__ 532 565 5e-3 SMART
FH2 600 1060 9.99e-110 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000221317
AA Change: G964R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000223272
AA Change: G973R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell motility, adhesion, cytokinesis, and other functions of the cell cortex are mediated by reorganization of the actin cytoskeleton and several formin homology (FH) proteins have been associated with these processes. The protein encoded by this gene contains two FH domains and belongs to a novel FH protein subfamily implicated in cell polarity. A key regulator of cytoskeletal architecture, the small GTPase Rho, is activated during development by Wnt/Fz signaling to control cell polarity and movement. The protein encoded by this gene is thought to function as a scaffolding protein for the Wnt-induced assembly of a disheveled (Dvl)-Rho complex. This protein also promotes the nucleation and elongation of new actin filaments and regulates cell growth through the stabilization of microtubules. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a gene trap allele show reduced fetal size, partial embryonic and neonatal lethality, altered cytoskeletal structure, cardiac defects including ventricular noncompaction, double outlet right ventricles and ventricular septal defects, and impaired cell adhesion and wound healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3100002H09Rik A G 4: 124,610,652 S36P probably damaging Het
AF067061 T C 13: 120,263,371 probably benign Het
Agmo A G 12: 37,252,539 D125G probably damaging Het
Arhgap26 A T 18: 39,357,827 S328C probably null Het
Arl6 T C 16: 59,618,806 D175G probably damaging Het
Asb3 G A 11: 31,055,559 A192T probably damaging Het
Atp10b A T 11: 43,235,746 M1110L possibly damaging Het
Cacna1i T C 15: 80,336,682 I175T probably damaging Het
Car15 A T 16: 17,837,363 I71N probably benign Het
Casq1 T A 1: 172,216,840 Y140F probably benign Het
Ccdc93 C T 1: 121,434,540 T17M possibly damaging Het
Cfap46 CCTTCTTCT CCTTCT 7: 139,638,900 probably benign Het
Ciart G A 3: 95,881,011 probably benign Het
Cul5 A T 9: 53,646,794 V170D probably benign Het
Cyb5r3 T C 15: 83,154,716 D224G probably benign Het
Daglb T A 5: 143,489,934 L383Q probably damaging Het
Dazap2 T G 15: 100,616,983 H28Q possibly damaging Het
Dnttip2 A T 3: 122,275,256 D40V probably benign Het
Epn1 G T 7: 5,095,926 D406Y probably damaging Het
Epn1 G T 7: 5,095,936 R409L probably damaging Het
Evc T C 5: 37,300,499 T966A probably benign Het
Extl3 T C 14: 65,076,926 D269G probably damaging Het
Gfra3 TGCGC TGC 18: 34,695,811 probably null Het
Gm4778 G T 3: 94,265,901 S72I probably damaging Het
Gpr87 A T 3: 59,179,107 F326I probably damaging Het
Hivep3 C A 4: 120,094,940 P151H probably damaging Het
Kcnj14 T A 7: 45,818,016 E302V probably damaging Het
Kdm5d T C Y: 921,693 Y534H probably damaging Homo
Map3k5 T A 10: 20,138,260 probably null Het
Marc1 G A 1: 184,795,451 R271W probably damaging Het
Mdn1 A G 4: 32,748,590 T4212A probably benign Het
Ms4a6d A T 19: 11,587,140 S122R probably damaging Het
Nectin3 A T 16: 46,395,150 H76Q probably damaging Het
Notch1 C A 2: 26,474,170 E846D possibly damaging Het
Olfr1200 T C 2: 88,768,288 E9G probably damaging Het
Olfr1537 T A 9: 39,238,218 I72F possibly damaging Het
Olfr382 A G 11: 73,516,708 S164P probably benign Het
Olfr883 G GGGATTGC 9: 38,026,537 probably null Het
Olfr883 TGTTT TGTTTGCAGTTT 9: 38,026,545 probably null Het
Olfr883 GTTT GTTTGCTTTTT 9: 38,026,546 probably null Het
Olfr883 TT TTGCTGTGT 9: 38,026,548 probably null Het
Pfkl C T 10: 77,989,565 probably null Het
Pigz T C 16: 31,945,606 V494A possibly damaging Het
Pik3r4 T C 9: 105,654,048 V516A probably benign Het
Polr2b G A 5: 77,348,294 R1104K probably benign Het
Rap1a A T 3: 105,731,995 L116* probably null Het
Rnf114 T C 2: 167,514,729 *230R probably null Het
Rtl1 G T 12: 109,593,649 N585K probably benign Het
Serpinb5 G T 1: 106,875,065 R110I possibly damaging Het
Spink6 T C 18: 44,074,431 probably null Het
Stk39 A T 2: 68,307,039 probably null Het
Tcte1 A T 17: 45,535,159 T230S probably benign Het
Tctex1d2 T A 16: 32,426,909 D125E possibly damaging Het
Tecpr1 C A 5: 144,198,576 V1020L probably damaging Het
Tmc7 T C 7: 118,561,038 Y192C possibly damaging Het
Trim63 A T 4: 134,323,226 T274S probably benign Het
Wdr43 G A 17: 71,650,053 probably null Het
Zfr T C 15: 12,160,591 I750T probably benign Het
Other mutations in Daam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Daam1 APN 12 71942219 missense unknown
IGL00323:Daam1 APN 12 71958743 splice site probably benign
IGL00885:Daam1 APN 12 71944091 missense unknown
IGL01768:Daam1 APN 12 71989885 missense probably benign 0.39
IGL02189:Daam1 APN 12 71946285 missense unknown
IGL02237:Daam1 APN 12 71982721 missense probably benign 0.01
IGL02486:Daam1 APN 12 71947145 splice site probably benign
IGL02561:Daam1 APN 12 71946516 missense unknown
IGL02699:Daam1 APN 12 71988943 missense probably damaging 1.00
IGL02977:Daam1 APN 12 71944172 missense unknown
R0390:Daam1 UTSW 12 71975304 splice site probably benign
R0492:Daam1 UTSW 12 71944380 missense unknown
R0780:Daam1 UTSW 12 71947050 missense unknown
R0973:Daam1 UTSW 12 71915784 missense unknown
R0973:Daam1 UTSW 12 71915784 missense unknown
R0974:Daam1 UTSW 12 71915784 missense unknown
R1264:Daam1 UTSW 12 71975311 splice site probably benign
R1462:Daam1 UTSW 12 71944142 missense unknown
R1462:Daam1 UTSW 12 71944142 missense unknown
R1510:Daam1 UTSW 12 71977726 missense probably damaging 1.00
R1535:Daam1 UTSW 12 71951918 missense unknown
R1688:Daam1 UTSW 12 71947046 missense unknown
R1713:Daam1 UTSW 12 71895882 missense unknown
R1957:Daam1 UTSW 12 71982755 critical splice donor site probably null
R1974:Daam1 UTSW 12 71988929 missense probably damaging 0.99
R2217:Daam1 UTSW 12 71989827 missense probably damaging 1.00
R2507:Daam1 UTSW 12 71975223 missense probably damaging 1.00
R2508:Daam1 UTSW 12 71975223 missense probably damaging 1.00
R3161:Daam1 UTSW 12 71947098 missense unknown
R3748:Daam1 UTSW 12 71971166 missense probably damaging 1.00
R3749:Daam1 UTSW 12 71971166 missense probably damaging 1.00
R4635:Daam1 UTSW 12 71958744 splice site probably null
R4862:Daam1 UTSW 12 71942207 missense unknown
R5033:Daam1 UTSW 12 71946520 missense unknown
R5180:Daam1 UTSW 12 71947125 missense unknown
R5202:Daam1 UTSW 12 71944274 missense unknown
R5254:Daam1 UTSW 12 71946576 missense unknown
R5358:Daam1 UTSW 12 71952459 nonsense probably null
R5413:Daam1 UTSW 12 71946292 missense unknown
R5733:Daam1 UTSW 12 71945498 missense unknown
R5752:Daam1 UTSW 12 71946546 missense unknown
R5891:Daam1 UTSW 12 71944149 missense unknown
R6111:Daam1 UTSW 12 71942264 missense unknown
R6182:Daam1 UTSW 12 71959887 nonsense probably null
R6252:Daam1 UTSW 12 71988949 missense probably damaging 1.00
R6291:Daam1 UTSW 12 71946251 missense unknown
R6379:Daam1 UTSW 12 71951938 missense unknown
R6776:Daam1 UTSW 12 71989808 missense possibly damaging 0.96
R7167:Daam1 UTSW 12 71988904 missense probably damaging 0.99
R7223:Daam1 UTSW 12 71988943 missense probably damaging 1.00
R7340:Daam1 UTSW 12 71988939 missense probably benign 0.28
R7467:Daam1 UTSW 12 71985806 nonsense probably null
R7709:Daam1 UTSW 12 71977649 missense probably benign 0.10
R7715:Daam1 UTSW 12 71988901 missense probably benign 0.15
R8157:Daam1 UTSW 12 71952489 missense probably damaging 1.00
R8187:Daam1 UTSW 12 71895828 missense unknown
R8297:Daam1 UTSW 12 71951915 missense unknown
R8963:Daam1 UTSW 12 71945244 missense unknown
R9283:Daam1 UTSW 12 71988922 missense probably damaging 1.00
R9402:Daam1 UTSW 12 71959830 missense probably benign 0.09
R9563:Daam1 UTSW 12 71945477 missense unknown
X0019:Daam1 UTSW 12 71985692 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAATTGGCTGGCTAAGAACCC -3'
(R):5'- GTATCTGTCGTCATGTGGCAC -3'

Sequencing Primer
(F):5'- GCTAAGAACCCTCCGTTGTATTTGAG -3'
(R):5'- GGGAAAGGCCAACCCACTG -3'
Posted On 2018-03-15