Incidental Mutation 'R6252:Idh1'
ID506262
Institutional Source Beutler Lab
Gene Symbol Idh1
Ensembl Gene ENSMUSG00000025950
Gene Nameisocitrate dehydrogenase 1 (NADP+), soluble
SynonymsId-1, Idh-1, IDPc, E030024J03Rik
MMRRC Submission 044369-MU
Accession Numbers

Genbank: NM_001111320, NM_010497 

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6252 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location65158616-65186500 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 65168531 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 163 (Q163P)
Ref Sequence ENSEMBL: ENSMUSP00000139906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097709] [ENSMUST00000149310] [ENSMUST00000169032] [ENSMUST00000186222] [ENSMUST00000188109] [ENSMUST00000188876]
Predicted Effect probably benign
Transcript: ENSMUST00000097709
AA Change: Q163P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095316
Gene: ENSMUSG00000025950
AA Change: Q163P

DomainStartEndE-ValueType
Iso_dh 9 401 1.05e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149310
SMART Domains Protein: ENSMUSP00000117853
Gene: ENSMUSG00000025950

DomainStartEndE-ValueType
Iso_dh 9 143 1.74e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169032
AA Change: Q163P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127307
Gene: ENSMUSG00000025950
AA Change: Q163P

DomainStartEndE-ValueType
Iso_dh 9 401 1.05e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186222
SMART Domains Protein: ENSMUSP00000140694
Gene: ENSMUSG00000025950

DomainStartEndE-ValueType
Pfam:Iso_dh 9 84 3.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188109
AA Change: Q163P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140757
Gene: ENSMUSG00000025950
AA Change: Q163P

DomainStartEndE-ValueType
Iso_dh 9 202 1.1e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188876
AA Change: Q163P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139906
Gene: ENSMUSG00000025950
AA Change: Q163P

DomainStartEndE-ValueType
Iso_dh 9 187 2.2e-9 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. Each NADP(+)-dependent isozyme is a homodimer. The protein encoded by this gene is the NADP(+)-dependent isocitrate dehydrogenase found in the cytoplasm and peroxisomes. It contains the PTS-1 peroxisomal targeting signal sequence. The presence of this enzyme in peroxisomes suggests roles in the regeneration of NADPH for intraperoxisomal reductions, such as the conversion of 2, 4-dienoyl-CoAs to 3-enoyl-CoAs, as well as in peroxisomal reactions that consume 2-oxoglutarate, namely the alpha-hydroxylation of phytanic acid. The cytoplasmic enzyme serves a significant role in cytoplasmic NADPH production. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Electrophoretic variation has been shown in tissues of liver, kidney, spleen and muscle. Strains C57BL/6, C3H/He carry the a allele; DBA/2 carries the b allele; M.m. castaneus and M.m. molossinus carry the c allele; the d allele is found at low frequencyin M. m. molossinus in Japan. [provided by MGI curators]
Allele List at MGI

All alleles(14) : Targeted, other(3) Gene trapped(11)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,283,754 Q4474R probably benign Het
9330182L06Rik T C 5: 9,410,693 Y205H probably damaging Het
Abcb11 T C 2: 69,291,961 I393V probably benign Het
Agl C T 3: 116,787,229 probably null Het
Ankrd11 T C 8: 122,893,822 E1097G possibly damaging Het
Aoc1 A G 6: 48,906,081 H297R probably benign Het
AW146154 G A 7: 41,481,387 P102S probably benign Het
Cap1 A G 4: 122,872,400 V15A probably benign Het
Cavin2 A G 1: 51,289,669 N95S probably benign Het
Col11a2 T A 17: 34,042,212 D45E probably null Het
Col8a1 A G 16: 57,627,005 V714A unknown Het
Crispld1 A G 1: 17,749,507 E243G probably benign Het
Daam1 G A 12: 71,988,949 G964R probably damaging Het
Epg5 T C 18: 77,985,167 F1308L probably damaging Het
Eqtn A T 4: 94,907,769 S232T probably damaging Het
Esyt1 T C 10: 128,511,902 E973G probably benign Het
Fbxl13 T A 5: 21,621,501 M96L possibly damaging Het
Frem2 A T 3: 53,572,448 F1941L probably damaging Het
Gbf1 T C 19: 46,271,556 V1050A probably benign Het
Hecw1 T C 13: 14,272,079 H721R probably damaging Het
Kctd15 A G 7: 34,641,923 V193A probably benign Het
Npas3 A G 12: 54,068,890 Y834C probably damaging Het
Olfr1493-ps1 A T 19: 13,727,055 S265C probably damaging Het
Opn4 C T 14: 34,594,831 V334I probably benign Het
Pappa A G 4: 65,189,412 M687V probably benign Het
Pcdhgc5 T C 18: 37,821,530 F619S probably damaging Het
Pdlim2 G T 14: 70,167,688 Q243K probably damaging Het
Pkd1 T C 17: 24,581,226 L2987P probably damaging Het
Plcz1 A G 6: 140,007,603 probably null Het
Prpf6 C T 2: 181,647,363 A615V probably damaging Het
Pwp1 T C 10: 85,874,509 V5A probably benign Het
Rsph10b T A 5: 143,937,121 D13E possibly damaging Het
Slc44a3 T A 3: 121,513,737 D200V probably damaging Het
St7l T C 3: 104,919,503 probably null Het
Stc2 T A 11: 31,360,346 D230V probably damaging Het
Syne2 C A 12: 75,969,436 T3264K probably benign Het
Trp73 C A 4: 154,064,397 D252Y probably damaging Het
Ubr1 T C 2: 120,906,895 D1056G probably benign Het
Vcan C T 13: 89,691,220 W1108* probably null Het
Zfp772 G T 7: 7,204,019 S224R possibly damaging Het
Zfp804b A T 5: 6,769,478 V1159E probably damaging Het
Zfp981 T G 4: 146,537,513 S298R probably benign Het
Zmat3 A G 3: 32,341,621 F246L possibly damaging Het
Zranb1 A G 7: 132,983,904 T720A probably benign Het
Other mutations in Idh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Idh1 APN 1 65166243 missense probably damaging 1.00
IGL00790:Idh1 APN 1 65166122 missense possibly damaging 0.94
IGL00979:Idh1 APN 1 65171149 missense probably damaging 1.00
IGL01397:Idh1 APN 1 65168595 missense possibly damaging 0.62
IGL02226:Idh1 APN 1 65161922 missense probably damaging 1.00
IGL02933:Idh1 APN 1 65161913 missense probably damaging 1.00
B5639:Idh1 UTSW 1 65165098 critical splice donor site probably null
R0310:Idh1 UTSW 1 65161920 missense probably damaging 1.00
R0865:Idh1 UTSW 1 65161156 missense probably benign
R1172:Idh1 UTSW 1 65161160 missense probably benign 0.00
R1173:Idh1 UTSW 1 65161160 missense probably benign 0.00
R1174:Idh1 UTSW 1 65161160 missense probably benign 0.00
R1535:Idh1 UTSW 1 65168538 missense probably damaging 1.00
R1833:Idh1 UTSW 1 65161114 missense probably benign
R2135:Idh1 UTSW 1 65161919 missense probably damaging 1.00
R5434:Idh1 UTSW 1 65175336 missense probably benign 0.00
R5478:Idh1 UTSW 1 65161838 missense probably benign 0.04
R5633:Idh1 UTSW 1 65165136 missense probably damaging 1.00
R6152:Idh1 UTSW 1 65159530 missense probably damaging 1.00
R6249:Idh1 UTSW 1 65166219 missense probably damaging 1.00
R7238:Idh1 UTSW 1 65166125 missense probably damaging 1.00
R7754:Idh1 UTSW 1 65159490 missense probably benign 0.00
R7819:Idh1 UTSW 1 65165118 missense probably damaging 1.00
R8064:Idh1 UTSW 1 65166179 missense probably damaging 1.00
R8078:Idh1 UTSW 1 65161066 missense probably damaging 0.97
R8187:Idh1 UTSW 1 65159541 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAGGCAATTGCATAACTACCCC -3'
(R):5'- AGCCTCAAGTTACACTGCTG -3'

Sequencing Primer
(F):5'- ACAGAGATCTGACTGCCTCTG -3'
(R):5'- CTGGTGTTTGGCTCCAAAATC -3'
Posted On2018-03-15