Incidental Mutation 'R6252:Prpf6'
ID506265
Institutional Source Beutler Lab
Gene Symbol Prpf6
Ensembl Gene ENSMUSG00000002455
Gene Namepre-mRNA splicing factor 6
SynonymsANT-1, U5-102K, 2610031L17Rik, 1190003A07Rik
MMRRC Submission 044369-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6252 (G1)
Quality Score167.009
Status Not validated
Chromosome2
Chromosomal Location181591868-181655660 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 181647363 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 615 (A615V)
Ref Sequence ENSEMBL: ENSMUSP00000121340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002529] [ENSMUST00000136481]
Predicted Effect probably damaging
Transcript: ENSMUST00000002529
AA Change: A615V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002529
Gene: ENSMUSG00000002455
AA Change: A615V

DomainStartEndE-ValueType
Pfam:PRP1_N 13 169 2.5e-52 PFAM
low complexity region 220 236 N/A INTRINSIC
HAT 289 321 1.83e-1 SMART
HAT 323 355 2.83e1 SMART
HAT 384 416 1.08e-3 SMART
HAT 417 446 1.61e1 SMART
HAT 447 476 6.92e-2 SMART
HAT 554 586 2.2e-4 SMART
HAT 588 620 1.69e2 SMART
HAT 622 654 1.38e-1 SMART
HAT 656 687 3.41e1 SMART
HAT 689 721 3.99e1 SMART
HAT 723 755 3.38e-5 SMART
HAT 757 789 2.48e-3 SMART
HAT 791 823 5.64e1 SMART
Blast:TPR 841 874 2e-14 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000136481
AA Change: A615V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121340
Gene: ENSMUSG00000002455
AA Change: A615V

DomainStartEndE-ValueType
Pfam:PRP1_N 13 169 1.3e-62 PFAM
low complexity region 220 236 N/A INTRINSIC
HAT 289 321 1.83e-1 SMART
HAT 323 355 2.83e1 SMART
HAT 384 416 1.08e-3 SMART
HAT 417 446 1.61e1 SMART
HAT 447 476 6.92e-2 SMART
HAT 554 586 2.2e-4 SMART
HAT 588 620 1.69e2 SMART
HAT 622 654 1.38e-1 SMART
HAT 656 687 3.41e1 SMART
HAT 689 721 3.99e1 SMART
HAT 723 755 3.38e-5 SMART
HAT 757 789 2.48e-3 SMART
HAT 791 823 5.64e1 SMART
Blast:TPR 841 874 2e-14 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene appears to be involved in pre-mRNA splicing, possibly acting as a bridging factor between U5 and U4/U6 snRNPs in formation of the spliceosome. The encoded protein also can bind androgen receptor, providing a link between transcriptional activation and splicing. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,283,754 Q4474R probably benign Het
9330182L06Rik T C 5: 9,410,693 Y205H probably damaging Het
Abcb11 T C 2: 69,291,961 I393V probably benign Het
Agl C T 3: 116,787,229 probably null Het
Ankrd11 T C 8: 122,893,822 E1097G possibly damaging Het
Aoc1 A G 6: 48,906,081 H297R probably benign Het
AW146154 G A 7: 41,481,387 P102S probably benign Het
Cap1 A G 4: 122,872,400 V15A probably benign Het
Cavin2 A G 1: 51,289,669 N95S probably benign Het
Col11a2 T A 17: 34,042,212 D45E probably null Het
Col8a1 A G 16: 57,627,005 V714A unknown Het
Crispld1 A G 1: 17,749,507 E243G probably benign Het
Daam1 G A 12: 71,988,949 G964R probably damaging Het
Epg5 T C 18: 77,985,167 F1308L probably damaging Het
Eqtn A T 4: 94,907,769 S232T probably damaging Het
Esyt1 T C 10: 128,511,902 E973G probably benign Het
Fbxl13 T A 5: 21,621,501 M96L possibly damaging Het
Frem2 A T 3: 53,572,448 F1941L probably damaging Het
Gbf1 T C 19: 46,271,556 V1050A probably benign Het
Hecw1 T C 13: 14,272,079 H721R probably damaging Het
Idh1 T G 1: 65,168,531 Q163P probably benign Het
Kctd15 A G 7: 34,641,923 V193A probably benign Het
Npas3 A G 12: 54,068,890 Y834C probably damaging Het
Olfr1493-ps1 A T 19: 13,727,055 S265C probably damaging Het
Opn4 C T 14: 34,594,831 V334I probably benign Het
Pappa A G 4: 65,189,412 M687V probably benign Het
Pcdhgc5 T C 18: 37,821,530 F619S probably damaging Het
Pdlim2 G T 14: 70,167,688 Q243K probably damaging Het
Pkd1 T C 17: 24,581,226 L2987P probably damaging Het
Plcz1 A G 6: 140,007,603 probably null Het
Pwp1 T C 10: 85,874,509 V5A probably benign Het
Rsph10b T A 5: 143,937,121 D13E possibly damaging Het
Slc44a3 T A 3: 121,513,737 D200V probably damaging Het
St7l T C 3: 104,919,503 probably null Het
Stc2 T A 11: 31,360,346 D230V probably damaging Het
Syne2 C A 12: 75,969,436 T3264K probably benign Het
Trp73 C A 4: 154,064,397 D252Y probably damaging Het
Ubr1 T C 2: 120,906,895 D1056G probably benign Het
Vcan C T 13: 89,691,220 W1108* probably null Het
Zfp772 G T 7: 7,204,019 S224R possibly damaging Het
Zfp804b A T 5: 6,769,478 V1159E probably damaging Het
Zfp981 T G 4: 146,537,513 S298R probably benign Het
Zmat3 A G 3: 32,341,621 F246L possibly damaging Het
Zranb1 A G 7: 132,983,904 T720A probably benign Het
Other mutations in Prpf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01461:Prpf6 APN 2 181631511 missense probably benign
IGL01729:Prpf6 APN 2 181654917 missense probably damaging 1.00
IGL02077:Prpf6 APN 2 181640664 missense probably damaging 1.00
IGL02187:Prpf6 APN 2 181616016 missense probably damaging 1.00
IGL02452:Prpf6 APN 2 181649085 missense probably benign 0.00
IGL02881:Prpf6 APN 2 181632071 missense probably benign 0.21
IGL03220:Prpf6 APN 2 181632879 missense probably damaging 1.00
IGL02837:Prpf6 UTSW 2 181622263 missense probably damaging 1.00
R0069:Prpf6 UTSW 2 181615963 splice site probably null
R0189:Prpf6 UTSW 2 181655457 missense probably benign 0.00
R0479:Prpf6 UTSW 2 181651127 missense probably benign 0.18
R0532:Prpf6 UTSW 2 181622211 missense possibly damaging 0.71
R0628:Prpf6 UTSW 2 181636048 missense probably damaging 0.96
R0674:Prpf6 UTSW 2 181631974 missense probably benign 0.05
R1863:Prpf6 UTSW 2 181608174 missense possibly damaging 0.81
R1954:Prpf6 UTSW 2 181632077 missense probably benign
R1955:Prpf6 UTSW 2 181632077 missense probably benign
R4612:Prpf6 UTSW 2 181632079 missense possibly damaging 0.81
R4627:Prpf6 UTSW 2 181601474 missense probably damaging 0.96
R5033:Prpf6 UTSW 2 181650106 missense possibly damaging 0.69
R5053:Prpf6 UTSW 2 181649453 missense probably benign 0.00
R5121:Prpf6 UTSW 2 181636043 missense probably benign
R5181:Prpf6 UTSW 2 181649546 missense probably damaging 0.98
R5380:Prpf6 UTSW 2 181608266 missense probably damaging 1.00
R5490:Prpf6 UTSW 2 181608165 missense probably benign 0.01
R5638:Prpf6 UTSW 2 181645588 missense probably benign 0.32
R5680:Prpf6 UTSW 2 181649140 missense probably damaging 0.99
R6152:Prpf6 UTSW 2 181621787 missense probably damaging 1.00
R6317:Prpf6 UTSW 2 181631436 missense probably benign 0.06
R6501:Prpf6 UTSW 2 181621920 nonsense probably null
R6789:Prpf6 UTSW 2 181616051 nonsense probably null
R7023:Prpf6 UTSW 2 181620640 missense probably damaging 1.00
R7043:Prpf6 UTSW 2 181649504 missense probably benign
R7214:Prpf6 UTSW 2 181640596 missense probably damaging 1.00
R7538:Prpf6 UTSW 2 181652455 missense probably benign 0.16
R7696:Prpf6 UTSW 2 181608242 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ACCGAACTTTGGAGTGGTAAC -3'
(R):5'- ATGCTTTGACCCCATAAATCAGG -3'

Sequencing Primer
(F):5'- AGTGGTAACTGTCTTTTCAGCATC -3'
(R):5'- AGTGTCTCTAGACTAGACCATGGC -3'
Posted On2018-03-15