Incidental Mutation 'R6252:Zmat3'
ID506266
Institutional Source Beutler Lab
Gene Symbol Zmat3
Ensembl Gene ENSMUSG00000027663
Gene Namezinc finger matrin type 3
SynonymsWig1
MMRRC Submission 044369-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R6252 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location32334792-32366014 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32341621 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 246 (F246L)
Ref Sequence ENSEMBL: ENSMUSP00000131317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029199] [ENSMUST00000168566]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029199
AA Change: F246L

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029199
Gene: ENSMUSG00000027663
AA Change: F246L

DomainStartEndE-ValueType
ZnF_U1 67 101 1.03e-10 SMART
ZnF_C2H2 70 94 9.46e0 SMART
ZnF_U1 145 179 1.11e-10 SMART
ZnF_C2H2 148 172 5.54e1 SMART
ZnF_U1 243 277 7.72e-10 SMART
ZnF_C2H2 246 270 6.92e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168566
AA Change: F246L

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131317
Gene: ENSMUSG00000027663
AA Change: F246L

DomainStartEndE-ValueType
ZnF_U1 67 101 1.03e-10 SMART
ZnF_C2H2 70 94 9.46e0 SMART
ZnF_U1 145 179 1.11e-10 SMART
ZnF_C2H2 148 172 5.54e1 SMART
ZnF_U1 243 277 7.72e-10 SMART
ZnF_C2H2 246 270 6.92e0 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing three zinc finger domains and a nuclear localization signal. The mRNA and the protein of this gene are upregulated by wildtype p53 and overexpression of this gene inhibits tumor cell growth, suggesting that this gene may have a role in the p53-dependent growth regulatory pathway. Alternative splicing of this gene results in two transcript variants encoding two isoforms differing in only one amino acid. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,283,754 Q4474R probably benign Het
9330182L06Rik T C 5: 9,410,693 Y205H probably damaging Het
Abcb11 T C 2: 69,291,961 I393V probably benign Het
Agl C T 3: 116,787,229 probably null Het
Ankrd11 T C 8: 122,893,822 E1097G possibly damaging Het
Aoc1 A G 6: 48,906,081 H297R probably benign Het
AW146154 G A 7: 41,481,387 P102S probably benign Het
Cap1 A G 4: 122,872,400 V15A probably benign Het
Cavin2 A G 1: 51,289,669 N95S probably benign Het
Col11a2 T A 17: 34,042,212 D45E probably null Het
Col8a1 A G 16: 57,627,005 V714A unknown Het
Crispld1 A G 1: 17,749,507 E243G probably benign Het
Daam1 G A 12: 71,988,949 G964R probably damaging Het
Epg5 T C 18: 77,985,167 F1308L probably damaging Het
Eqtn A T 4: 94,907,769 S232T probably damaging Het
Esyt1 T C 10: 128,511,902 E973G probably benign Het
Fbxl13 T A 5: 21,621,501 M96L possibly damaging Het
Frem2 A T 3: 53,572,448 F1941L probably damaging Het
Gbf1 T C 19: 46,271,556 V1050A probably benign Het
Hecw1 T C 13: 14,272,079 H721R probably damaging Het
Idh1 T G 1: 65,168,531 Q163P probably benign Het
Kctd15 A G 7: 34,641,923 V193A probably benign Het
Npas3 A G 12: 54,068,890 Y834C probably damaging Het
Olfr1493-ps1 A T 19: 13,727,055 S265C probably damaging Het
Opn4 C T 14: 34,594,831 V334I probably benign Het
Pappa A G 4: 65,189,412 M687V probably benign Het
Pcdhgc5 T C 18: 37,821,530 F619S probably damaging Het
Pdlim2 G T 14: 70,167,688 Q243K probably damaging Het
Pkd1 T C 17: 24,581,226 L2987P probably damaging Het
Plcz1 A G 6: 140,007,603 probably null Het
Prpf6 C T 2: 181,647,363 A615V probably damaging Het
Pwp1 T C 10: 85,874,509 V5A probably benign Het
Rsph10b T A 5: 143,937,121 D13E possibly damaging Het
Slc44a3 T A 3: 121,513,737 D200V probably damaging Het
St7l T C 3: 104,919,503 probably null Het
Stc2 T A 11: 31,360,346 D230V probably damaging Het
Syne2 C A 12: 75,969,436 T3264K probably benign Het
Trp73 C A 4: 154,064,397 D252Y probably damaging Het
Ubr1 T C 2: 120,906,895 D1056G probably benign Het
Vcan C T 13: 89,691,220 W1108* probably null Het
Zfp772 G T 7: 7,204,019 S224R possibly damaging Het
Zfp804b A T 5: 6,769,478 V1159E probably damaging Het
Zfp981 T G 4: 146,537,513 S298R probably benign Het
Zranb1 A G 7: 132,983,904 T720A probably benign Het
Other mutations in Zmat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Zmat3 APN 3 32341678 missense possibly damaging 0.82
IGL01687:Zmat3 APN 3 32341531 missense probably damaging 1.00
IGL02251:Zmat3 APN 3 32345583 splice site probably benign
IGL03110:Zmat3 APN 3 32345552 missense probably damaging 0.98
R0585:Zmat3 UTSW 3 32361105 missense probably damaging 0.96
R1258:Zmat3 UTSW 3 32343671 missense probably damaging 0.99
R1916:Zmat3 UTSW 3 32343348 missense probably benign 0.00
R1968:Zmat3 UTSW 3 32360982 missense probably damaging 1.00
R4805:Zmat3 UTSW 3 32343355 missense probably benign 0.00
R4906:Zmat3 UTSW 3 32343687 missense probably damaging 1.00
R6844:Zmat3 UTSW 3 32341495 missense probably damaging 1.00
R7998:Zmat3 UTSW 3 32341666 missense possibly damaging 0.89
R8316:Zmat3 UTSW 3 32341521 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACAGGCAGGACAGGCTTC -3'
(R):5'- TGGACATTCTAAGGATCTGCG -3'

Sequencing Primer
(F):5'- ACAGGCTTCTCTGTGAGGAC -3'
(R):5'- TCACGCATTGACTAGGCTAG -3'
Posted On2018-03-15