Mutagenetix > Incidental Mutation

Incidental Mutation 'R6252:Frem2'

506267

Institutional Source

Beutler Lab

Gene Symbol

Frem2

Ensembl Gene

ENSMUSG00000037016

Gene Name

Fras1 related extracellular matrix protein 2

Synonyms

my, ne, 6030440P17Rik, b2b1562Clo, 8430406N05Rik

MMRRC Submission

044369-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6252 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

53513938-53657355 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 53572448 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 1941 (F1941L)

Ref Sequence

ENSEMBL: ENSMUSP00000088670 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091137]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000091137
AA Change: F1941L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000088670
Gene: ENSMUSG00000037016
AA Change: F1941L

Domain	Start	End	E-Value	Type
signal peptide	1	39	N/A	INTRINSIC
Pfam:Cadherin_3	249	388	4.3e-9	PFAM
Pfam:Cadherin_3	376	532	3e-34	PFAM
Pfam:Cadherin_3	516	665	7.5e-24	PFAM
Pfam:Cadherin_3	632	798	1.6e-21	PFAM
Pfam:Cadherin_3	763	910	1.2e-25	PFAM
Pfam:Cadherin_3	879	1027	5.1e-18	PFAM
Pfam:Cadherin_3	1015	1159	2.2e-20	PFAM
CA	1202	1293	4.8e-1	SMART
Pfam:Cadherin_3	1392	1503	9.8e-24	PFAM
Pfam:Cadherin_3	1504	1612	6.2e-28	PFAM
Pfam:Cadherin_3	1613	1743	5.3e-20	PFAM
Calx_beta	1748	1847	1.5e-5	SMART
Calx_beta	1860	1971	9.47e-12	SMART
Calx_beta	1985	2092	1.65e-11	SMART
Calx_beta	2105	2209	1.99e-5	SMART
Calx_beta	2227	2331	6.9e-14	SMART
transmembrane domain	3103	3125	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The encoded protein localizes to the basement membrane, forming a ternary complex that plays a role in epidermal-dermal interactions. This protein is important for the integrity of skin and renal epithelia. Mutations in this gene are associated with Fraser syndrome. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for mutations at this locus display a significant amount of embryonic lethality due to hemorrhaging of embryonic blisters. Kidney development is severely affected and syndactyly is common. Phenotypes of homozygous mutants are indistinguishable from those of Fras1 homozygous mutant. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	T	C	10: 82,283,754	Q4474R	probably benign	Het
9330182L06Rik	T	C	5: 9,410,693	Y205H	probably damaging	Het
Abcb11	T	C	2: 69,291,961	I393V	probably benign	Het
Agl	C	T	3: 116,787,229		probably null	Het
Ankrd11	T	C	8: 122,893,822	E1097G	possibly damaging	Het
Aoc1	A	G	6: 48,906,081	H297R	probably benign	Het
AW146154	G	A	7: 41,481,387	P102S	probably benign	Het
Cap1	A	G	4: 122,872,400	V15A	probably benign	Het
Cavin2	A	G	1: 51,289,669	N95S	probably benign	Het
Col11a2	T	A	17: 34,042,212	D45E	probably null	Het
Col8a1	A	G	16: 57,627,005	V714A	unknown	Het
Crispld1	A	G	1: 17,749,507	E243G	probably benign	Het
Daam1	G	A	12: 71,988,949	G964R	probably damaging	Het
Epg5	T	C	18: 77,985,167	F1308L	probably damaging	Het
Eqtn	A	T	4: 94,907,769	S232T	probably damaging	Het
Esyt1	T	C	10: 128,511,902	E973G	probably benign	Het
Fbxl13	T	A	5: 21,621,501	M96L	possibly damaging	Het
Gbf1	T	C	19: 46,271,556	V1050A	probably benign	Het
Hecw1	T	C	13: 14,272,079	H721R	probably damaging	Het
Idh1	T	G	1: 65,168,531	Q163P	probably benign	Het
Kctd15	A	G	7: 34,641,923	V193A	probably benign	Het
Npas3	A	G	12: 54,068,890	Y834C	probably damaging	Het
Olfr1493-ps1	A	T	19: 13,727,055	S265C	probably damaging	Het
Opn4	C	T	14: 34,594,831	V334I	probably benign	Het
Pappa	A	G	4: 65,189,412	M687V	probably benign	Het
Pcdhgc5	T	C	18: 37,821,530	F619S	probably damaging	Het
Pdlim2	G	T	14: 70,167,688	Q243K	probably damaging	Het
Pkd1	T	C	17: 24,581,226	L2987P	probably damaging	Het
Plcz1	A	G	6: 140,007,603		probably null	Het
Prpf6	C	T	2: 181,647,363	A615V	probably damaging	Het
Pwp1	T	C	10: 85,874,509	V5A	probably benign	Het
Rsph10b	T	A	5: 143,937,121	D13E	possibly damaging	Het
Slc44a3	T	A	3: 121,513,737	D200V	probably damaging	Het
St7l	T	C	3: 104,919,503		probably null	Het
Stc2	T	A	11: 31,360,346	D230V	probably damaging	Het
Syne2	C	A	12: 75,969,436	T3264K	probably benign	Het
Trp73	C	A	4: 154,064,397	D252Y	probably damaging	Het
Ubr1	T	C	2: 120,906,895	D1056G	probably benign	Het
Vcan	C	T	13: 89,691,220	W1108*	probably null	Het
Zfp772	G	T	7: 7,204,019	S224R	possibly damaging	Het
Zfp804b	A	T	5: 6,769,478	V1159E	probably damaging	Het
Zfp981	T	G	4: 146,537,513	S298R	probably benign	Het
Zmat3	A	G	3: 32,341,621	F246L	possibly damaging	Het
Zranb1	A	G	7: 132,983,904	T720A	probably benign	Het

Other mutations in Frem2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00895:Frem2	APN	3	53585595	missense	probably damaging	1.00
IGL00911:Frem2	APN	3	53572462	missense	probably damaging	1.00
IGL01322:Frem2	APN	3	53541038	missense	probably benign	0.00
IGL01330:Frem2	APN	3	53655241	missense	possibly damaging	0.70
IGL01406:Frem2	APN	3	53525896	missense	probably damaging	1.00
IGL01556:Frem2	APN	3	53535281	missense	probably benign	0.23
IGL01580:Frem2	APN	3	53655175	missense	probably damaging	1.00
IGL01606:Frem2	APN	3	53653591	missense	possibly damaging	0.69
IGL01611:Frem2	APN	3	53655709	missense	probably benign	0.00
IGL01648:Frem2	APN	3	53535732	missense	possibly damaging	0.86
IGL01663:Frem2	APN	3	53517013	missense	probably damaging	1.00
IGL01665:Frem2	APN	3	53549662	missense	probably benign	0.07
IGL01670:Frem2	APN	3	53656937	missense	possibly damaging	0.95
IGL01960:Frem2	APN	3	53522304	missense	probably benign	0.33
IGL02175:Frem2	APN	3	53655599	missense	possibly damaging	0.69
IGL02201:Frem2	APN	3	53519640	missense	probably benign	0.35
IGL02202:Frem2	APN	3	53654799	missense	probably benign	0.00
IGL02427:Frem2	APN	3	53535763	missense	probably damaging	0.97
IGL02457:Frem2	APN	3	53521049	missense	probably damaging	0.99
IGL02638:Frem2	APN	3	53551346	missense	possibly damaging	0.94
IGL02801:Frem2	APN	3	53652175	missense	possibly damaging	0.85
IGL03023:Frem2	APN	3	53655628	missense	probably benign	0.40
IGL03169:Frem2	APN	3	53522292	missense	probably benign	0.01
IGL03238:Frem2	APN	3	53656261	missense	possibly damaging	0.93
IGL03251:Frem2	APN	3	53572308	missense	probably benign	0.01
IGL03273:Frem2	APN	3	53537509	nonsense	probably null
IGL03343:Frem2	APN	3	53652253	missense	probably damaging	1.00
Biosimilar	UTSW	3	53654323	missense	probably benign	0.01
Fruit_stripe	UTSW	3	53537489	missense	probably benign	0.21
PIT4366001:Frem2	UTSW	3	53653201	missense	probably damaging	0.98
R0019:Frem2	UTSW	3	53523678	missense	probably damaging	0.99
R0092:Frem2	UTSW	3	53589796	missense	probably benign	0.03
R0108:Frem2	UTSW	3	53647961	missense	probably benign	0.03
R0115:Frem2	UTSW	3	53656208	missense	probably damaging	0.99
R0118:Frem2	UTSW	3	53535243	nonsense	probably null
R0374:Frem2	UTSW	3	53653960	missense	probably damaging	1.00
R0437:Frem2	UTSW	3	53653015	missense	possibly damaging	0.96
R0531:Frem2	UTSW	3	53519954	missense	probably damaging	1.00
R0555:Frem2	UTSW	3	53516860	missense	probably damaging	0.97
R0564:Frem2	UTSW	3	53656109	missense	probably damaging	0.97
R0586:Frem2	UTSW	3	53647921	missense	probably damaging	0.99
R0726:Frem2	UTSW	3	53519626	missense	possibly damaging	0.89
R0925:Frem2	UTSW	3	53653973	missense	probably benign
R1233:Frem2	UTSW	3	53547778	missense	probably damaging	0.98
R1302:Frem2	UTSW	3	53655538	missense	probably benign	0.00
R1333:Frem2	UTSW	3	53549731	missense	probably benign	0.26
R1446:Frem2	UTSW	3	53654596	missense	probably benign	0.31
R1523:Frem2	UTSW	3	53655407	missense	possibly damaging	0.73
R1539:Frem2	UTSW	3	53654210	missense	probably benign	0.19
R1543:Frem2	UTSW	3	53572455	missense	possibly damaging	0.86
R1597:Frem2	UTSW	3	53654519	missense	probably benign	0.19
R1600:Frem2	UTSW	3	53547723	missense	probably damaging	1.00
R1678:Frem2	UTSW	3	53519938	missense	probably damaging	1.00
R1687:Frem2	UTSW	3	53653952	missense	probably benign
R1696:Frem2	UTSW	3	53656042	nonsense	probably null
R1758:Frem2	UTSW	3	53653357	missense	probably damaging	1.00
R1857:Frem2	UTSW	3	53654873	missense	probably benign	0.10
R1869:Frem2	UTSW	3	53535196	missense	probably benign	0.04
R1921:Frem2	UTSW	3	53653495	missense	possibly damaging	0.76
R1973:Frem2	UTSW	3	53652232	missense	probably benign	0.01
R2045:Frem2	UTSW	3	53535744	missense	probably damaging	1.00
R2113:Frem2	UTSW	3	53652922	missense	probably damaging	1.00
R2152:Frem2	UTSW	3	53517029	nonsense	probably null
R2164:Frem2	UTSW	3	53537330	missense	probably damaging	1.00
R2181:Frem2	UTSW	3	53574587	missense	possibly damaging	0.72
R2201:Frem2	UTSW	3	53516573	missense	probably benign
R2221:Frem2	UTSW	3	53516857	missense	probably benign	0.00
R2255:Frem2	UTSW	3	53652514	missense	probably damaging	0.96
R2280:Frem2	UTSW	3	53572423	missense	probably damaging	1.00
R3196:Frem2	UTSW	3	53537331	missense	probably damaging	1.00
R3716:Frem2	UTSW	3	53572360	missense	probably damaging	1.00
R3807:Frem2	UTSW	3	53653449	missense	probably benign	0.22
R3820:Frem2	UTSW	3	53516849	missense	probably damaging	1.00
R3821:Frem2	UTSW	3	53652415	missense	probably damaging	1.00
R3977:Frem2	UTSW	3	53652070	missense	probably benign	0.00
R3979:Frem2	UTSW	3	53652070	missense	probably benign	0.00
R4014:Frem2	UTSW	3	53652353	missense	probably benign	0.01
R4127:Frem2	UTSW	3	53525896	missense	probably damaging	1.00
R4195:Frem2	UTSW	3	53539268	missense	possibly damaging	0.90
R4196:Frem2	UTSW	3	53539268	missense	possibly damaging	0.90
R4374:Frem2	UTSW	3	53545502	missense	possibly damaging	0.61
R4427:Frem2	UTSW	3	53539162	critical splice donor site	probably null
R4428:Frem2	UTSW	3	53654338	missense	probably benign	0.40
R4559:Frem2	UTSW	3	53654321	missense	probably benign	0.01
R4600:Frem2	UTSW	3	53547807	missense	possibly damaging	0.96
R4602:Frem2	UTSW	3	53547807	missense	possibly damaging	0.96
R4610:Frem2	UTSW	3	53547807	missense	possibly damaging	0.96
R4611:Frem2	UTSW	3	53547807	missense	possibly damaging	0.96
R4661:Frem2	UTSW	3	53655443	missense	probably damaging	1.00
R4678:Frem2	UTSW	3	53544371	missense	probably benign	0.00
R4689:Frem2	UTSW	3	53547635	missense	probably benign	0.43
R4740:Frem2	UTSW	3	53535819	missense	probably benign	0.04
R4748:Frem2	UTSW	3	53541093	missense	probably damaging	1.00
R4790:Frem2	UTSW	3	53516741	missense	probably benign
R4809:Frem2	UTSW	3	53653895	missense	probably benign	0.01
R4930:Frem2	UTSW	3	53656315	missense	possibly damaging	0.93
R4971:Frem2	UTSW	3	53539183	missense	probably damaging	1.00
R5057:Frem2	UTSW	3	53535196	missense	probably benign	0.37
R5202:Frem2	UTSW	3	53551346	missense	probably benign	0.41
R5221:Frem2	UTSW	3	53585611	missense	probably damaging	1.00
R5231:Frem2	UTSW	3	53522295	missense	probably damaging	1.00
R5268:Frem2	UTSW	3	53653154	missense	probably damaging	0.96
R5480:Frem2	UTSW	3	53656507	nonsense	probably null
R5637:Frem2	UTSW	3	53652937	missense	probably damaging	0.97
R5664:Frem2	UTSW	3	53652490	missense	probably benign	0.33
R5698:Frem2	UTSW	3	53652505	missense	possibly damaging	0.89
R5744:Frem2	UTSW	3	53655959	missense	probably damaging	1.00
R5754:Frem2	UTSW	3	53537258	missense	probably damaging	1.00
R5808:Frem2	UTSW	3	53652563	missense	probably damaging	0.96
R5840:Frem2	UTSW	3	53647921	missense	probably damaging	0.99
R5874:Frem2	UTSW	3	53537489	missense	probably benign	0.21
R6050:Frem2	UTSW	3	53653012	missense	probably damaging	0.99
R6103:Frem2	UTSW	3	53549788	missense	probably benign	0.00
R6149:Frem2	UTSW	3	53551341	missense	probably damaging	0.98
R6182:Frem2	UTSW	3	53647969	missense	probably damaging	1.00
R6191:Frem2	UTSW	3	53655280	missense	probably benign	0.10
R6245:Frem2	UTSW	3	53655824	missense	probably benign	0.00
R6393:Frem2	UTSW	3	53585640	missense	possibly damaging	0.91
R6416:Frem2	UTSW	3	53572378	missense	probably benign	0.01
R6595:Frem2	UTSW	3	53549784	missense	probably damaging	1.00
R6665:Frem2	UTSW	3	53654656	missense	probably damaging	1.00
R6708:Frem2	UTSW	3	53585501	missense	probably benign	0.00
R6751:Frem2	UTSW	3	53653665	missense	probably damaging	1.00
R6787:Frem2	UTSW	3	53654323	missense	probably benign	0.01
R6913:Frem2	UTSW	3	53516821	missense	probably damaging	1.00
R6916:Frem2	UTSW	3	53547688	missense	probably damaging	1.00
R7017:Frem2	UTSW	3	53519602	missense	probably benign	0.02
R7083:Frem2	UTSW	3	53537493	missense	probably damaging	0.99
R7108:Frem2	UTSW	3	53653513	missense	probably damaging	1.00
R7133:Frem2	UTSW	3	53572339	missense	possibly damaging	0.82
R7326:Frem2	UTSW	3	53654753	missense	probably damaging	1.00
R7341:Frem2	UTSW	3	53654495	missense	probably damaging	1.00
R7455:Frem2	UTSW	3	53572280	splice site	probably null
R7487:Frem2	UTSW	3	53654549	missense	probably benign	0.40
R7495:Frem2	UTSW	3	53516837	missense	probably benign	0.13
R7542:Frem2	UTSW	3	53652579	missense	probably damaging	1.00
R7636:Frem2	UTSW	3	53653247	missense	probably benign	0.00
R7703:Frem2	UTSW	3	53522168	missense	probably benign	0.01
R7750:Frem2	UTSW	3	53523682	missense	possibly damaging	0.83
R7849:Frem2	UTSW	3	53572374	missense	probably damaging	1.00
R7922:Frem2	UTSW	3	53653304	missense	probably damaging	0.98
R8008:Frem2	UTSW	3	53652910	missense	probably damaging	1.00
R8051:Frem2	UTSW	3	53535355	missense	probably benign	0.04
R8052:Frem2	UTSW	3	53549643	missense	probably benign	0.02
R8176:Frem2	UTSW	3	53655340	missense	possibly damaging	0.50
R8220:Frem2	UTSW	3	53656507	nonsense	probably null
R8397:Frem2	UTSW	3	53653141	missense	probably benign	0.00
R8410:Frem2	UTSW	3	53539177	missense	possibly damaging	0.60
R8697:Frem2	UTSW	3	53525828	missense	probably damaging	0.99
R9134:Frem2	UTSW	3	53654900	missense	probably damaging	1.00
R9183:Frem2	UTSW	3	53520065	missense	probably damaging	1.00
R9260:Frem2	UTSW	3	53652783	missense	probably damaging	1.00
R9267:Frem2	UTSW	3	53657083	start codon destroyed	probably null	0.00
R9299:Frem2	UTSW	3	53656559	missense	probably benign	0.37
R9378:Frem2	UTSW	3	53651989	missense	probably damaging	0.99
R9444:Frem2	UTSW	3	53652844	missense	probably benign	0.10
R9459:Frem2	UTSW	3	53653486	missense	probably benign
R9487:Frem2	UTSW	3	53653484	missense	possibly damaging	0.95
Z1177:Frem2	UTSW	3	53535166	missense	probably null	1.00
Z1177:Frem2	UTSW	3	53655607	missense	probably benign	0.31

Predicted Primers

PCR Primer
(F):5'- AGAACTCACCATCATCCCTGTCTG -3'
(R):5'- GGCTGTATAGGGTTGCAACAG -3'

Sequencing Primer
(F):5'- CATCATCCCTGTCTGTGAGGATG -3'
(R):5'- CAGATTTCTGAGTTCGAGGCCAAC -3'

Posted On

2018-03-15