Incidental Mutation 'R6252:AW146154'
ID506284
Institutional Source Beutler Lab
Gene Symbol AW146154
Ensembl Gene ENSMUSG00000074166
Gene Nameexpressed sequence AW146154
Synonyms
MMRRC Submission 044369-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R6252 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location41478874-41499890 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 41481387 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 102 (P102S)
Ref Sequence ENSEMBL: ENSMUSP00000096109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094532] [ENSMUST00000098509]
Predicted Effect probably benign
Transcript: ENSMUST00000094532
Predicted Effect probably benign
Transcript: ENSMUST00000098509
AA Change: P102S

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000096109
Gene: ENSMUSG00000074166
AA Change: P102S

DomainStartEndE-ValueType
KRAB 4 66 9.86e-14 SMART
ZnF_C2H2 75 97 9.08e1 SMART
ZnF_C2H2 131 153 7.78e-3 SMART
ZnF_C2H2 159 181 4.72e-2 SMART
ZnF_C2H2 187 209 3.63e-3 SMART
ZnF_C2H2 215 237 8.47e-4 SMART
ZnF_C2H2 243 265 4.24e-4 SMART
ZnF_C2H2 271 293 5.81e-2 SMART
ZnF_C2H2 299 321 2.61e-4 SMART
ZnF_C2H2 327 349 2.12e-4 SMART
ZnF_C2H2 355 377 1.6e-4 SMART
ZnF_C2H2 383 405 8.47e-4 SMART
ZnF_C2H2 411 433 6.88e-4 SMART
ZnF_C2H2 439 461 1.6e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205572
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,283,754 Q4474R probably benign Het
9330182L06Rik T C 5: 9,410,693 Y205H probably damaging Het
Abcb11 T C 2: 69,291,961 I393V probably benign Het
Agl C T 3: 116,787,229 probably null Het
Ankrd11 T C 8: 122,893,822 E1097G possibly damaging Het
Aoc1 A G 6: 48,906,081 H297R probably benign Het
Cap1 A G 4: 122,872,400 V15A probably benign Het
Cavin2 A G 1: 51,289,669 N95S probably benign Het
Col11a2 T A 17: 34,042,212 D45E probably null Het
Col8a1 A G 16: 57,627,005 V714A unknown Het
Crispld1 A G 1: 17,749,507 E243G probably benign Het
Daam1 G A 12: 71,988,949 G964R probably damaging Het
Epg5 T C 18: 77,985,167 F1308L probably damaging Het
Eqtn A T 4: 94,907,769 S232T probably damaging Het
Esyt1 T C 10: 128,511,902 E973G probably benign Het
Fbxl13 T A 5: 21,621,501 M96L possibly damaging Het
Frem2 A T 3: 53,572,448 F1941L probably damaging Het
Gbf1 T C 19: 46,271,556 V1050A probably benign Het
Hecw1 T C 13: 14,272,079 H721R probably damaging Het
Idh1 T G 1: 65,168,531 Q163P probably benign Het
Kctd15 A G 7: 34,641,923 V193A probably benign Het
Npas3 A G 12: 54,068,890 Y834C probably damaging Het
Olfr1493-ps1 A T 19: 13,727,055 S265C probably damaging Het
Opn4 C T 14: 34,594,831 V334I probably benign Het
Pappa A G 4: 65,189,412 M687V probably benign Het
Pcdhgc5 T C 18: 37,821,530 F619S probably damaging Het
Pdlim2 G T 14: 70,167,688 Q243K probably damaging Het
Pkd1 T C 17: 24,581,226 L2987P probably damaging Het
Plcz1 A G 6: 140,007,603 probably null Het
Prpf6 C T 2: 181,647,363 A615V probably damaging Het
Pwp1 T C 10: 85,874,509 V5A probably benign Het
Rsph10b T A 5: 143,937,121 D13E possibly damaging Het
Slc44a3 T A 3: 121,513,737 D200V probably damaging Het
St7l T C 3: 104,919,503 probably null Het
Stc2 T A 11: 31,360,346 D230V probably damaging Het
Syne2 C A 12: 75,969,436 T3264K probably benign Het
Trp73 C A 4: 154,064,397 D252Y probably damaging Het
Ubr1 T C 2: 120,906,895 D1056G probably benign Het
Vcan C T 13: 89,691,220 W1108* probably null Het
Zfp772 G T 7: 7,204,019 S224R possibly damaging Het
Zfp804b A T 5: 6,769,478 V1159E probably damaging Het
Zfp981 T G 4: 146,537,513 S298R probably benign Het
Zmat3 A G 3: 32,341,621 F246L possibly damaging Het
Zranb1 A G 7: 132,983,904 T720A probably benign Het
Other mutations in AW146154
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:AW146154 APN 7 41480459 missense probably damaging 1.00
R1351:AW146154 UTSW 7 41480454 missense probably damaging 1.00
R3763:AW146154 UTSW 7 41480370 missense probably damaging 1.00
R4829:AW146154 UTSW 7 41480633 missense possibly damaging 0.62
R4835:AW146154 UTSW 7 41480468 missense probably damaging 1.00
R5326:AW146154 UTSW 7 41481377 missense probably benign 0.00
R5542:AW146154 UTSW 7 41481377 missense probably benign 0.00
R5976:AW146154 UTSW 7 41480297 missense probably damaging 0.99
R7006:AW146154 UTSW 7 41481224 missense possibly damaging 0.50
R7053:AW146154 UTSW 7 41482564 critical splice donor site probably null
R7096:AW146154 UTSW 7 41481443 missense probably benign 0.32
R7649:AW146154 UTSW 7 41480732 missense probably benign 0.13
R8069:AW146154 UTSW 7 41480511 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GACATGCAAAGGCTTGACCAC -3'
(R):5'- TCACAGGTATCTTCAGAGACACAAAA -3'

Sequencing Primer
(F):5'- CCACACTGGTTACATTCATAGGG -3'
(R):5'- GTGGAAACCTTAAGATCTGATTCCTC -3'
Posted On2018-03-15