Incidental Mutation 'R6252:4932415D10Rik'
ID506287
Institutional Source Beutler Lab
Gene Symbol 4932415D10Rik
Ensembl Gene ENSMUSG00000044581
Gene NameRIKEN cDNA 4932415D10 gene
Synonyms
MMRRC Submission 044369-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R6252 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location82282116-82316582 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82283754 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 4474 (Q4474R)
Ref Sequence ENSEMBL: ENSMUSP00000151425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171401] [ENSMUST00000217661]
Predicted Effect probably benign
Transcript: ENSMUST00000171401
AA Change: Q504R

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000126178
Gene: ENSMUSG00000044581
AA Change: Q504R

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 241 263 N/A INTRINSIC
low complexity region 387 405 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217661
AA Change: Q4474R

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T C 5: 9,410,693 Y205H probably damaging Het
Abcb11 T C 2: 69,291,961 I393V probably benign Het
Agl C T 3: 116,787,229 probably null Het
Ankrd11 T C 8: 122,893,822 E1097G possibly damaging Het
Aoc1 A G 6: 48,906,081 H297R probably benign Het
AW146154 G A 7: 41,481,387 P102S probably benign Het
Cap1 A G 4: 122,872,400 V15A probably benign Het
Cavin2 A G 1: 51,289,669 N95S probably benign Het
Col11a2 T A 17: 34,042,212 D45E probably null Het
Col8a1 A G 16: 57,627,005 V714A unknown Het
Crispld1 A G 1: 17,749,507 E243G probably benign Het
Daam1 G A 12: 71,988,949 G964R probably damaging Het
Epg5 T C 18: 77,985,167 F1308L probably damaging Het
Eqtn A T 4: 94,907,769 S232T probably damaging Het
Esyt1 T C 10: 128,511,902 E973G probably benign Het
Fbxl13 T A 5: 21,621,501 M96L possibly damaging Het
Frem2 A T 3: 53,572,448 F1941L probably damaging Het
Gbf1 T C 19: 46,271,556 V1050A probably benign Het
Hecw1 T C 13: 14,272,079 H721R probably damaging Het
Idh1 T G 1: 65,168,531 Q163P probably benign Het
Kctd15 A G 7: 34,641,923 V193A probably benign Het
Npas3 A G 12: 54,068,890 Y834C probably damaging Het
Olfr1493-ps1 A T 19: 13,727,055 S265C probably damaging Het
Opn4 C T 14: 34,594,831 V334I probably benign Het
Pappa A G 4: 65,189,412 M687V probably benign Het
Pcdhgc5 T C 18: 37,821,530 F619S probably damaging Het
Pdlim2 G T 14: 70,167,688 Q243K probably damaging Het
Pkd1 T C 17: 24,581,226 L2987P probably damaging Het
Plcz1 A G 6: 140,007,603 probably null Het
Prpf6 C T 2: 181,647,363 A615V probably damaging Het
Pwp1 T C 10: 85,874,509 V5A probably benign Het
Rsph10b T A 5: 143,937,121 D13E possibly damaging Het
Slc44a3 T A 3: 121,513,737 D200V probably damaging Het
St7l T C 3: 104,919,503 probably null Het
Stc2 T A 11: 31,360,346 D230V probably damaging Het
Syne2 C A 12: 75,969,436 T3264K probably benign Het
Trp73 C A 4: 154,064,397 D252Y probably damaging Het
Ubr1 T C 2: 120,906,895 D1056G probably benign Het
Vcan C T 13: 89,691,220 W1108* probably null Het
Zfp772 G T 7: 7,204,019 S224R possibly damaging Het
Zfp804b A T 5: 6,769,478 V1159E probably damaging Het
Zfp981 T G 4: 146,537,513 S298R probably benign Het
Zmat3 A G 3: 32,341,621 F246L possibly damaging Het
Zranb1 A G 7: 132,983,904 T720A probably benign Het
Other mutations in 4932415D10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:4932415D10Rik APN 10 82283752 missense probably benign 0.06
IGL01457:4932415D10Rik APN 10 82284734 missense probably damaging 1.00
IGL01540:4932415D10Rik APN 10 82284182 missense possibly damaging 0.87
IGL02693:4932415D10Rik APN 10 82285258 missense probably benign 0.06
IGL02867:4932415D10Rik APN 10 82283820 missense probably damaging 0.96
IGL02889:4932415D10Rik APN 10 82283820 missense probably damaging 0.96
IGL03080:4932415D10Rik APN 10 82283982 missense probably damaging 0.99
IGL03120:4932415D10Rik APN 10 82285035 missense possibly damaging 0.90
IGL03351:4932415D10Rik APN 10 82283567 utr 3 prime probably benign
FR4449:4932415D10Rik UTSW 10 82285469 frame shift probably null
FR4548:4932415D10Rik UTSW 10 82290996 small insertion probably benign
FR4737:4932415D10Rik UTSW 10 82285469 small deletion probably benign
PIT4480001:4932415D10Rik UTSW 10 82283752 missense probably benign 0.06
R0102:4932415D10Rik UTSW 10 82283556 missense probably damaging 1.00
R0312:4932415D10Rik UTSW 10 82284369 missense probably damaging 1.00
R1303:4932415D10Rik UTSW 10 82284556 missense possibly damaging 0.94
R2039:4932415D10Rik UTSW 10 82284676 missense probably damaging 1.00
R2356:4932415D10Rik UTSW 10 82283955 missense possibly damaging 0.94
R4740:4932415D10Rik UTSW 10 82283647 missense possibly damaging 0.50
R4857:4932415D10Rik UTSW 10 82283848 missense possibly damaging 0.61
R5017:4932415D10Rik UTSW 10 82296676 missense unknown
R5095:4932415D10Rik UTSW 10 82283667 missense probably damaging 1.00
R5209:4932415D10Rik UTSW 10 82283818 missense possibly damaging 0.84
R5388:4932415D10Rik UTSW 10 82283727 missense probably damaging 0.99
R5642:4932415D10Rik UTSW 10 82284483 missense probably damaging 1.00
R5646:4932415D10Rik UTSW 10 82283776 missense probably damaging 0.99
R6188:4932415D10Rik UTSW 10 82285257 missense probably damaging 0.96
R6215:4932415D10Rik UTSW 10 82291112 missense probably benign 0.07
R6275:4932415D10Rik UTSW 10 82285368 missense probably damaging 1.00
R6303:4932415D10Rik UTSW 10 82290368 missense possibly damaging 0.79
R6304:4932415D10Rik UTSW 10 82290368 missense possibly damaging 0.79
R6313:4932415D10Rik UTSW 10 82293636 missense probably benign 0.00
R6323:4932415D10Rik UTSW 10 82283082 missense probably benign 0.27
R6374:4932415D10Rik UTSW 10 82288897 unclassified probably benign
R6407:4932415D10Rik UTSW 10 82293811 missense probably benign 0.16
R6468:4932415D10Rik UTSW 10 82295316 missense probably benign 0.01
R6490:4932415D10Rik UTSW 10 82289304 missense possibly damaging 0.90
R6605:4932415D10Rik UTSW 10 82296037 missense probably benign 0.27
R6614:4932415D10Rik UTSW 10 82291648 missense probably benign 0.31
R6626:4932415D10Rik UTSW 10 82292833 missense probably benign 0.03
R6630:4932415D10Rik UTSW 10 82287072 missense possibly damaging 0.81
R6646:4932415D10Rik UTSW 10 82296830 missense unknown
R6723:4932415D10Rik UTSW 10 82289823 missense possibly damaging 0.50
R6751:4932415D10Rik UTSW 10 82283497 missense probably benign 0.06
R6850:4932415D10Rik UTSW 10 82293054 missense possibly damaging 0.68
R6944:4932415D10Rik UTSW 10 82296222 missense probably benign 0.03
R6957:4932415D10Rik UTSW 10 82293786 missense probably benign 0.03
R6988:4932415D10Rik UTSW 10 82291899 missense possibly damaging 0.79
R7069:4932415D10Rik UTSW 10 82289943 missense probably damaging 0.99
R7164:4932415D10Rik UTSW 10 82286229 missense probably damaging 1.00
R7175:4932415D10Rik UTSW 10 82286749 missense probably damaging 1.00
R7201:4932415D10Rik UTSW 10 82291627 missense probably benign 0.03
R7203:4932415D10Rik UTSW 10 82293414 missense probably benign 0.00
R7205:4932415D10Rik UTSW 10 82289327 missense probably benign 0.35
R7241:4932415D10Rik UTSW 10 82287042 missense probably benign 0.01
R7283:4932415D10Rik UTSW 10 82291297 missense possibly damaging 0.90
R7305:4932415D10Rik UTSW 10 82285119 missense probably benign 0.06
R7358:4932415D10Rik UTSW 10 82292013 missense possibly damaging 0.79
R7360:4932415D10Rik UTSW 10 82296507 missense unknown
R7362:4932415D10Rik UTSW 10 82292997 missense possibly damaging 0.79
R7385:4932415D10Rik UTSW 10 82287737 missense probably benign 0.03
R7385:4932415D10Rik UTSW 10 82287895 missense probably benign 0.05
R7472:4932415D10Rik UTSW 10 82283587 missense probably benign 0.03
R7493:4932415D10Rik UTSW 10 82288964 nonsense probably null
R7493:4932415D10Rik UTSW 10 82316430 missense unknown
R7498:4932415D10Rik UTSW 10 82291279 missense probably benign 0.03
R7512:4932415D10Rik UTSW 10 82292635 missense probably benign 0.31
R7560:4932415D10Rik UTSW 10 82284615 missense probably damaging 1.00
R7591:4932415D10Rik UTSW 10 82292212 missense probably benign 0.16
R7636:4932415D10Rik UTSW 10 82295139 missense probably benign 0.01
R7640:4932415D10Rik UTSW 10 82294656 missense probably damaging 0.99
R7709:4932415D10Rik UTSW 10 82290532 missense possibly damaging 0.81
R7790:4932415D10Rik UTSW 10 82287495 missense probably benign 0.06
RF017:4932415D10Rik UTSW 10 82290992 small insertion probably benign
RF055:4932415D10Rik UTSW 10 82290993 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TGACCACAAATTGTCTGGCC -3'
(R):5'- GCCAAAGACTATGAATTCTGTCAG -3'

Sequencing Primer
(F):5'- GACCACAAATTGTCTGGCCTCATC -3'
(R):5'- GACTATGAATTCTGTCAGGTTCACTC -3'
Posted On2018-03-15