Incidental Mutation 'R6252:Pdlim2'
ID 506297
Institutional Source Beutler Lab
Gene Symbol Pdlim2
Ensembl Gene ENSMUSG00000022090
Gene Name PDZ and LIM domain 2
Synonyms SLIM, 4732462F18Rik, mystique
MMRRC Submission 044369-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R6252 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 70401667-70415130 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 70405137 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 243 (Q243K)
Ref Sequence ENSEMBL: ENSMUSP00000116200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022681] [ENSMUST00000127836] [ENSMUST00000129174] [ENSMUST00000153735] [ENSMUST00000143393]
AlphaFold Q8R1G6
Predicted Effect probably damaging
Transcript: ENSMUST00000022681
AA Change: Q243K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022681
Gene: ENSMUSG00000022090
AA Change: Q243K

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
Pfam:DUF4749 169 256 4.4e-12 PFAM
low complexity region 259 271 N/A INTRINSIC
LIM 282 334 1.25e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123125
Predicted Effect unknown
Transcript: ENSMUST00000125300
AA Change: Q44K
SMART Domains Protein: ENSMUSP00000116694
Gene: ENSMUSG00000022090
AA Change: Q44K

DomainStartEndE-ValueType
Pfam:DUF4749 7 58 6.4e-13 PFAM
low complexity region 61 73 N/A INTRINSIC
LIM 84 136 1.25e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127836
AA Change: Q22K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141050
Gene: ENSMUSG00000022090
AA Change: Q22K

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
LIM 61 113 5.9e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000129174
AA Change: Q22K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139820
Gene: ENSMUSG00000022090
AA Change: Q22K

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
LIM 61 113 5.9e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135944
Predicted Effect probably damaging
Transcript: ENSMUST00000153735
AA Change: Q243K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116200
Gene: ENSMUSG00000022090
AA Change: Q243K

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
low complexity region 241 250 N/A INTRINSIC
low complexity region 259 271 N/A INTRINSIC
LIM 282 334 1.25e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138792
Predicted Effect probably benign
Transcript: ENSMUST00000143393
SMART Domains Protein: ENSMUSP00000119222
Gene: ENSMUSG00000022090

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141363
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ALP subfamily of PDZ-LIM domain proteins. The encoded protein suppresses anchorage-dependent growth and promotes cell migration and adhesion through interactions with the actin cytoskeleton via the PDZ domain. The encoded protein is also a putative tumor suppressor protein, and decreased expression of this gene is associated with several malignancies including breast cancer and adult T-cell leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele display increased IFN-gamma production by Th1 cells and an enhanced inflammatory response to in vivo challenge with heat-killed Listeria monocytogenes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,122,305 (GRCm39) I393V probably benign Het
Agl C T 3: 116,580,878 (GRCm39) probably null Het
Ankrd11 T C 8: 123,620,561 (GRCm39) E1097G possibly damaging Het
Aoc1 A G 6: 48,883,015 (GRCm39) H297R probably benign Het
AW146154 G A 7: 41,130,811 (GRCm39) P102S probably benign Het
Cap1 A G 4: 122,766,193 (GRCm39) V15A probably benign Het
Cavin2 A G 1: 51,328,828 (GRCm39) N95S probably benign Het
Col11a2 T A 17: 34,261,186 (GRCm39) D45E probably null Het
Col8a1 A G 16: 57,447,368 (GRCm39) V714A unknown Het
Crispld1 A G 1: 17,819,731 (GRCm39) E243G probably benign Het
Daam1 G A 12: 72,035,723 (GRCm39) G964R probably damaging Het
Elapor2 T C 5: 9,460,693 (GRCm39) Y205H probably damaging Het
Epg5 T C 18: 78,028,382 (GRCm39) F1308L probably damaging Het
Eqtn A T 4: 94,796,006 (GRCm39) S232T probably damaging Het
Esyt1 T C 10: 128,347,771 (GRCm39) E973G probably benign Het
Fbxl13 T A 5: 21,826,499 (GRCm39) M96L possibly damaging Het
Frem2 A T 3: 53,479,869 (GRCm39) F1941L probably damaging Het
Gbf1 T C 19: 46,259,995 (GRCm39) V1050A probably benign Het
Hecw1 T C 13: 14,446,664 (GRCm39) H721R probably damaging Het
Idh1 T G 1: 65,207,690 (GRCm39) Q163P probably benign Het
Kctd15 A G 7: 34,341,348 (GRCm39) V193A probably benign Het
Npas3 A G 12: 54,115,673 (GRCm39) Y834C probably damaging Het
Opn4 C T 14: 34,316,788 (GRCm39) V334I probably benign Het
Or10w3 A T 19: 13,704,419 (GRCm39) S265C probably damaging Het
Pappa A G 4: 65,107,649 (GRCm39) M687V probably benign Het
Pcdhgc5 T C 18: 37,954,583 (GRCm39) F619S probably damaging Het
Pkd1 T C 17: 24,800,200 (GRCm39) L2987P probably damaging Het
Plcz1 A G 6: 139,953,329 (GRCm39) probably null Het
Prpf6 C T 2: 181,289,156 (GRCm39) A615V probably damaging Het
Pwp1 T C 10: 85,710,373 (GRCm39) V5A probably benign Het
Rsph10b T A 5: 143,873,939 (GRCm39) D13E possibly damaging Het
Slc44a3 T A 3: 121,307,386 (GRCm39) D200V probably damaging Het
Spata31h1 T C 10: 82,119,588 (GRCm39) Q4474R probably benign Het
St7l T C 3: 104,826,819 (GRCm39) probably null Het
Stc2 T A 11: 31,310,346 (GRCm39) D230V probably damaging Het
Syne2 C A 12: 76,016,210 (GRCm39) T3264K probably benign Het
Trp73 C A 4: 154,148,854 (GRCm39) D252Y probably damaging Het
Ubr1 T C 2: 120,737,376 (GRCm39) D1056G probably benign Het
Vcan C T 13: 89,839,339 (GRCm39) W1108* probably null Het
Zfp772 G T 7: 7,207,018 (GRCm39) S224R possibly damaging Het
Zfp804b A T 5: 6,819,478 (GRCm39) V1159E probably damaging Het
Zfp981 T G 4: 146,621,970 (GRCm39) S298R probably benign Het
Zmat3 A G 3: 32,395,770 (GRCm39) F246L possibly damaging Het
Zranb1 A G 7: 132,585,633 (GRCm39) T720A probably benign Het
Other mutations in Pdlim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02295:Pdlim2 APN 14 70,403,532 (GRCm39) splice site probably benign
IGL02338:Pdlim2 APN 14 70,411,906 (GRCm39) missense probably damaging 1.00
IGL03286:Pdlim2 APN 14 70,411,925 (GRCm39) missense possibly damaging 0.88
PIT4504001:Pdlim2 UTSW 14 70,403,579 (GRCm39) missense probably benign 0.44
R0751:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R0768:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R0832:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1167:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1207:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1207:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1343:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1412:Pdlim2 UTSW 14 70,411,773 (GRCm39) splice site probably benign
R1595:Pdlim2 UTSW 14 70,402,193 (GRCm39) missense probably damaging 1.00
R1689:Pdlim2 UTSW 14 70,408,688 (GRCm39) missense probably damaging 0.98
R1703:Pdlim2 UTSW 14 70,411,784 (GRCm39) critical splice donor site probably null
R1843:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1845:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1923:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1924:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1925:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2004:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2005:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2202:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2205:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2237:Pdlim2 UTSW 14 70,408,698 (GRCm39) missense probably benign 0.05
R2843:Pdlim2 UTSW 14 70,403,549 (GRCm39) missense probably benign 0.02
R4042:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R4965:Pdlim2 UTSW 14 70,405,464 (GRCm39) unclassified probably benign
R4971:Pdlim2 UTSW 14 70,405,208 (GRCm39) missense probably damaging 1.00
R5951:Pdlim2 UTSW 14 70,405,229 (GRCm39) missense probably benign 0.06
R7208:Pdlim2 UTSW 14 70,411,826 (GRCm39) missense probably damaging 1.00
R7597:Pdlim2 UTSW 14 70,403,645 (GRCm39) missense possibly damaging 0.58
R7627:Pdlim2 UTSW 14 70,408,924 (GRCm39) missense probably benign
R8342:Pdlim2 UTSW 14 70,403,563 (GRCm39) missense probably damaging 1.00
R8554:Pdlim2 UTSW 14 70,408,698 (GRCm39) missense probably benign
R9361:Pdlim2 UTSW 14 70,402,190 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTACCACCCACCACTTTCTGAG -3'
(R):5'- CTCATATTTGTCTGCACCGGG -3'

Sequencing Primer
(F):5'- ACCCACCACTTTCTGAGGGTAC -3'
(R):5'- GGTGTGTCCCAACATCATTGCAG -3'
Posted On 2018-03-15