Mutagenetix > Incidental Mutations

Incidental Mutation 'R6253:Aqr'

506309

Institutional Source

Beutler Lab

Gene Symbol

Aqr

Ensembl Gene

ENSMUSG00000040383

Gene Name

aquarius

Synonyms

MMRRC Submission

044370-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6253 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

114101170-114187024 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 114156277 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 204 (D204G)

Ref Sequence

ENSEMBL: ENSMUSP00000047157 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043160] [ENSMUST00000102543]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043160
AA Change: D204G

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000047157
Gene: ENSMUSG00000040383
AA Change: D204G

Domain	Start	End	E-Value	Type
Pfam:Aquarius_N	18	802	N/A	PFAM
Pfam:ResIII	797	911	8.2e-7	PFAM
Pfam:AAA_11	801	1111	9.6e-32	PFAM
Pfam:AAA_19	807	894	3.7e-11	PFAM
Pfam:AAA_12	1119	1312	2.1e-27	PFAM
low complexity region	1394	1417	N/A	INTRINSIC
low complexity region	1455	1468	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102543
AA Change: D204G

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000099602
Gene: ENSMUSG00000040383
AA Change: D204G

Domain	Start	End	E-Value	Type
low complexity region	43	56	N/A	INTRINSIC
low complexity region	112	124	N/A	INTRINSIC
low complexity region	762	776	N/A	INTRINSIC
Pfam:AAA_11	801	1111	3.2e-32	PFAM
Pfam:AAA_19	807	893	6.5e-11	PFAM
Pfam:AAA_12	1119	1312	2.6e-27	PFAM
low complexity region	1348	1359	N/A	INTRINSIC
low complexity region	1371	1382	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125460

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129504

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131785

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921504E06Rik	A	G	2: 19,524,118	Y151H	possibly damaging	Het
Aasdh	A	G	5: 76,886,258	I482T	possibly damaging	Het
Abca3	G	A	17: 24,397,552	M989I	probably benign	Het
Acvr2b	C	T	9: 119,428,561	P220L	probably damaging	Het
Arpp19	G	T	9: 75,056,734	D123Y	probably damaging	Het
Bod1l	A	G	5: 41,826,538	I554T	probably damaging	Het
Bpifa5	A	G	2: 154,163,500	M1V	probably null	Het
Cdh3	T	A	8: 106,537,063		probably null	Het
Cep170	A	T	1: 176,780,394	D165E	possibly damaging	Het
Cfap46	CCTTCTTCT	CCTTCT	7: 139,638,900		probably benign	Het
Cog3	A	G	14: 75,719,712	L627P	probably damaging	Het
Col23a1	C	T	11: 51,574,168	L453F	probably damaging	Het
Cyp2a22	T	A	7: 26,934,232	Q351L	probably benign	Het
Ddx4	C	A	13: 112,636,022	E78*	probably null	Het
Ddx4	T	G	13: 112,636,023	K77N	probably benign	Het
Decr1	A	T	4: 15,931,179	N92K	probably benign	Het
Dnm2	T	C	9: 21,500,275	L600P	probably damaging	Het
Ece2	A	C	16: 20,639,182	N356H	probably damaging	Het
Ern1	A	T	11: 106,426,908	I130N	possibly damaging	Het
Fat2	G	A	11: 55,296,271	R1250C	probably damaging	Het
Fat4	T	A	3: 38,951,356	V1968D	probably damaging	Het
Frmd6	A	G	12: 70,877,213	K82E	probably damaging	Het
Gm5431	A	G	11: 48,894,999	V183A	probably benign	Het
Golgb1	T	C	16: 36,915,622	S1744P	possibly damaging	Het
Hnrnpa3	C	G	2: 75,662,570	Q213E	possibly damaging	Het
Hspa1a	A	G	17: 34,970,550	F459S	probably damaging	Het
Ice1	A	G	13: 70,603,164	L1601P	probably damaging	Het
Igkv19-93	T	A	6: 68,736,339	D102V	probably damaging	Het
Kansl1	G	A	11: 104,357,526	T534I	probably benign	Het
Lpin2	T	A	17: 71,231,269	S303R	probably damaging	Het
Lrpprc	T	A	17: 84,740,637	I845F	probably benign	Het
Mdn1	A	G	4: 32,749,593	T4259A	probably benign	Het
Mtss1	A	G	15: 58,943,719	I664T	probably benign	Het
Mum1	T	A	10: 80,233,014	C331S	probably benign	Het
Myh8	A	G	11: 67,301,967	E1528G	probably benign	Het
Myo5c	A	T	9: 75,245,037	E69V	probably damaging	Het
Myom3	A	T	4: 135,785,892	D627V	probably benign	Het
Myom3	A	G	4: 135,801,003	N1053S	probably benign	Het
Olfr1336	T	C	7: 6,460,548	V13A	probably benign	Het
Olfr17	G	A	7: 107,098,257	R264H	possibly damaging	Het
Olfr715b	A	T	7: 107,105,938	S308T	probably benign	Het
Phactr1	T	A	13: 43,094,771	S399T	probably benign	Het
Plch2	T	A	4: 155,007,101	Y84F	probably damaging	Het
Ppp1r13b	A	G	12: 111,835,726	S278P	probably benign	Het
Prol1	A	G	5: 88,327,877	Y42C	probably damaging	Het
Pum2	A	G	12: 8,748,205	E906G	probably damaging	Het
Rbp2	G	T	9: 98,490,647	S13I	probably benign	Het
Rbp4	G	A	19: 38,124,980	T30M	probably benign	Het
Selenbp1	T	C	3: 94,943,846	L351P	possibly damaging	Het
Serpinb6b	T	C	13: 32,972,272	F115S	probably damaging	Het
Soga1	T	C	2: 157,021,419	S1197G	probably benign	Het
Tigd3	A	T	19: 5,892,842	Y87N	probably damaging	Het
Tigd5	T	A	15: 75,911,022	L411H	probably damaging	Het
Ttc3	T	C	16: 94,457,413		probably null	Het
Uhmk1	T	C	1: 170,199,880	Q416R	probably damaging	Het
Zfand4	T	C	6: 116,273,614	F2L	probably damaging	Het
Zfhx3	C	T	8: 108,955,388	T3153M	possibly damaging	Het
Zfp697	T	G	3: 98,427,539	C207G	possibly damaging	Het
Zfp935	T	C	13: 62,454,871	T172A	probably benign	Het
Znrf3	G	T	11: 5,280,865	L883I	probably benign	Het

Other mutations in Aqr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Aqr	APN	2	114125942	missense	possibly damaging	0.90
IGL00694:Aqr	APN	2	114151525	missense	probably damaging	1.00
IGL02113:Aqr	APN	2	114120027	nonsense	probably null
IGL02297:Aqr	APN	2	114150481	missense	probably benign	0.24
IGL02380:Aqr	APN	2	114109936	missense	probably damaging	1.00
IGL02410:Aqr	APN	2	114136917	missense	possibly damaging	0.85
IGL02413:Aqr	APN	2	114118780	missense	possibly damaging	0.87
IGL02474:Aqr	APN	2	114112646	missense	probably damaging	1.00
IGL02941:Aqr	APN	2	114113354	missense	probably damaging	1.00
IGL02981:Aqr	APN	2	114134824	splice site	probably benign
IGL03001:Aqr	APN	2	114146919	missense	probably benign
IGL03092:Aqr	APN	2	114158943	missense	probably benign	0.38
IGL03222:Aqr	APN	2	114121256	missense	probably damaging	1.00
capricorn	UTSW	2	114105882	missense	probably damaging	1.00
Goat	UTSW	2	114157575	missense	probably damaging	1.00
Pliades	UTSW	2	114132976	missense	probably damaging	1.00
sagittarius	UTSW	2	114149016	missense	probably damaging	1.00
Zodiac	UTSW	2	114108109	missense	probably damaging	0.96
PIT4531001:Aqr	UTSW	2	114130734	missense	possibly damaging	0.94
R0103:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R0103:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R0152:Aqr	UTSW	2	114159010	missense	probably benign	0.07
R0352:Aqr	UTSW	2	114170052	missense	probably damaging	1.00
R0371:Aqr	UTSW	2	114157604	missense	possibly damaging	0.80
R0374:Aqr	UTSW	2	114130611	missense	probably damaging	1.00
R0550:Aqr	UTSW	2	114132976	missense	probably damaging	1.00
R0604:Aqr	UTSW	2	114130604	missense	probably benign	0.00
R0685:Aqr	UTSW	2	114140977	missense	probably damaging	1.00
R1236:Aqr	UTSW	2	114116655	missense	probably damaging	1.00
R1434:Aqr	UTSW	2	114150409	missense	probably damaging	1.00
R1806:Aqr	UTSW	2	114161652	missense	probably damaging	1.00
R2154:Aqr	UTSW	2	114137004	missense	probably damaging	1.00
R2185:Aqr	UTSW	2	114130534	critical splice donor site	probably null
R2377:Aqr	UTSW	2	114140940	missense	possibly damaging	0.58
R2862:Aqr	UTSW	2	114136917	missense	probably damaging	1.00
R3615:Aqr	UTSW	2	114136887	missense	probably damaging	1.00
R3616:Aqr	UTSW	2	114136887	missense	probably damaging	1.00
R3713:Aqr	UTSW	2	114118669	splice site	probably benign
R3715:Aqr	UTSW	2	114118669	splice site	probably benign
R4586:Aqr	UTSW	2	114112577	missense	probably benign	0.06
R4663:Aqr	UTSW	2	114161666	nonsense	probably null
R4809:Aqr	UTSW	2	114175214	utr 5 prime	probably benign
R4887:Aqr	UTSW	2	114150509	missense	probably damaging	1.00
R4888:Aqr	UTSW	2	114150509	missense	probably damaging	1.00
R4952:Aqr	UTSW	2	114109937	missense	probably damaging	1.00
R4974:Aqr	UTSW	2	114113351	missense	probably damaging	1.00
R5050:Aqr	UTSW	2	114112609	nonsense	probably null
R5050:Aqr	UTSW	2	114170025	critical splice donor site	probably null
R5213:Aqr	UTSW	2	114113327	missense	probably damaging	1.00
R5263:Aqr	UTSW	2	114116578	missense	probably damaging	1.00
R5470:Aqr	UTSW	2	114157575	missense	probably damaging	1.00
R5488:Aqr	UTSW	2	114133073	missense	probably damaging	1.00
R5489:Aqr	UTSW	2	114133073	missense	probably damaging	1.00
R5567:Aqr	UTSW	2	114148970	missense	probably damaging	1.00
R5570:Aqr	UTSW	2	114148970	missense	probably damaging	1.00
R5641:Aqr	UTSW	2	114149034	missense	probably damaging	1.00
R5685:Aqr	UTSW	2	114156265	missense	possibly damaging	0.87
R5963:Aqr	UTSW	2	114126961	missense	probably damaging	1.00
R5992:Aqr	UTSW	2	114143049	nonsense	probably null
R6015:Aqr	UTSW	2	114175165	start codon destroyed	probably null	0.53
R6264:Aqr	UTSW	2	114109964	missense	probably damaging	1.00
R6773:Aqr	UTSW	2	114148996	missense	possibly damaging	0.64
R6877:Aqr	UTSW	2	114116571	nonsense	probably null
R7211:Aqr	UTSW	2	114134723	missense	probably benign	0.01
R7232:Aqr	UTSW	2	114105882	missense	probably damaging	1.00
R7308:Aqr	UTSW	2	114104062	missense	possibly damaging	0.86
R7396:Aqr	UTSW	2	114119946	nonsense	probably null
R7490:Aqr	UTSW	2	114158868	critical splice donor site	probably null
R7526:Aqr	UTSW	2	114108109	missense	probably damaging	0.96
R7629:Aqr	UTSW	2	114114593	missense	probably damaging	1.00
R7828:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R8037:Aqr	UTSW	2	114161680	missense	probably damaging	1.00
R8166:Aqr	UTSW	2	114113325	missense	possibly damaging	0.95
R8712:Aqr	UTSW	2	114118877	missense	probably damaging	1.00
R8904:Aqr	UTSW	2	114136993	missense	not run
Z1176:Aqr	UTSW	2	114108122	missense	probably damaging	0.98
Z1176:Aqr	UTSW	2	114109991	missense	probably benign	0.25

Predicted Primers

PCR Primer
(F):5'- GGTGAGTGACCAAAATCTACTTG -3'
(R):5'- TTCAGATTGTCATAGGCCACATATCTG -3'

Sequencing Primer
(F):5'- GAAGACCTGAGCTTGTTCCCTAG -3'
(R):5'- TGTCATAGGCCACATATCTGAAGAG -3'

Posted On

2018-03-15