Incidental Mutation 'R6253:Plch2'
ID506319
Institutional Source Beutler Lab
Gene Symbol Plch2
Ensembl Gene ENSMUSG00000029055
Gene Namephospholipase C, eta 2
SynonymsPlcl4, A930027K05Rik, PLCeta2
MMRRC Submission 044370-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6253 (G1)
Quality Score213.009
Status Not validated
Chromosome4
Chromosomal Location154983115-155056784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 155007101 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 84 (Y84F)
Ref Sequence ENSEMBL: ENSMUSP00000134750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105631] [ENSMUST00000126098] [ENSMUST00000131173] [ENSMUST00000135665] [ENSMUST00000139976] [ENSMUST00000145662] [ENSMUST00000176194] [ENSMUST00000186598]
Predicted Effect possibly damaging
Transcript: ENSMUST00000105631
AA Change: Y185F

PolyPhen 2 Score 0.636 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101256
Gene: ENSMUSG00000029055
AA Change: Y185F

DomainStartEndE-ValueType
low complexity region 28 45 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
PH 122 231 1.8e-6 SMART
EFh 247 275 7.29e-4 SMART
EFh 283 312 4.67e-2 SMART
Pfam:EF-hand_like 317 399 1.7e-26 PFAM
PLCXc 400 545 6.76e-76 SMART
low complexity region 559 572 N/A INTRINSIC
low complexity region 659 676 N/A INTRINSIC
PLCYc 707 821 1.25e-56 SMART
C2 840 948 1.66e-21 SMART
low complexity region 1088 1107 N/A INTRINSIC
low complexity region 1227 1236 N/A INTRINSIC
low complexity region 1356 1369 N/A INTRINSIC
low complexity region 1421 1451 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126098
SMART Domains Protein: ENSMUSP00000115440
Gene: ENSMUSG00000029055

DomainStartEndE-ValueType
SCOP:d1mai__ 39 58 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131173
AA Change: Y102F

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000118629
Gene: ENSMUSG00000029055
AA Change: Y102F

DomainStartEndE-ValueType
Blast:PH 31 111 6e-49 BLAST
SCOP:d1mai__ 34 111 4e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000135665
AA Change: Y80F

PolyPhen 2 Score 0.583 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118292
Gene: ENSMUSG00000029055
AA Change: Y80F

DomainStartEndE-ValueType
PH 17 126 1.8e-6 SMART
EFh 142 170 7.29e-4 SMART
EFh 178 207 4.67e-2 SMART
Pfam:EF-hand_like 212 294 2.8e-25 PFAM
PLCXc 295 440 6.76e-76 SMART
low complexity region 454 467 N/A INTRINSIC
low complexity region 554 571 N/A INTRINSIC
PLCYc 602 716 1.25e-56 SMART
C2 735 843 1.66e-21 SMART
low complexity region 983 1002 N/A INTRINSIC
low complexity region 1122 1131 N/A INTRINSIC
low complexity region 1251 1264 N/A INTRINSIC
low complexity region 1316 1346 N/A INTRINSIC
low complexity region 1349 1361 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000139976
AA Change: Y185F

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122704
Gene: ENSMUSG00000029055
AA Change: Y185F

DomainStartEndE-ValueType
low complexity region 28 45 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
PH 122 231 1.8e-6 SMART
EFh 247 275 7.29e-4 SMART
EFh 283 312 4.67e-2 SMART
Pfam:EF-hand_like 317 399 3.2e-27 PFAM
PLCXc 400 545 6.76e-76 SMART
low complexity region 559 572 N/A INTRINSIC
low complexity region 659 676 N/A INTRINSIC
PLCYc 707 821 1.25e-56 SMART
C2 840 948 1.66e-21 SMART
low complexity region 1087 1100 N/A INTRINSIC
low complexity region 1166 1194 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145662
AA Change: Y109F

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000119864
Gene: ENSMUSG00000029055
AA Change: Y109F

DomainStartEndE-ValueType
PH 46 155 1.8e-6 SMART
EFh 171 199 7.29e-4 SMART
EFh 207 236 4.67e-2 SMART
Pfam:EF-hand_like 241 323 5.2e-27 PFAM
PLCXc 324 469 6.76e-76 SMART
low complexity region 483 496 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175982
Predicted Effect probably damaging
Transcript: ENSMUST00000176194
AA Change: Y84F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134750
Gene: ENSMUSG00000029055
AA Change: Y84F

DomainStartEndE-ValueType
PH 21 130 1.8e-6 SMART
EFh 146 174 7.29e-4 SMART
EFh 182 211 4.67e-2 SMART
Pfam:EF-hand_like 216 298 1.6e-25 PFAM
PLCXc 299 444 6.76e-76 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
PLCYc 606 720 1.25e-56 SMART
C2 739 847 1.66e-21 SMART
low complexity region 986 999 N/A INTRINSIC
low complexity region 1065 1093 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186598
AA Change: Y102F

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141152
Gene: ENSMUSG00000029055
AA Change: Y102F

DomainStartEndE-ValueType
C2 79 189 5.8e-18 SMART
low complexity region 328 341 N/A INTRINSIC
low complexity region 407 435 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PLCH2 is a member of the PLC-eta family of the phosphoinositide-specific phospholipase C (PLC) superfamily of enzymes that cleave PtdIns(4,5) P2 to generate second messengers inositol 1,4,5-trisphosphate and diacylglycerol (Zhou et al., 2005 [PubMed 16107206]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a reporter allele exhibit no apparent abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,524,118 Y151H possibly damaging Het
Aasdh A G 5: 76,886,258 I482T possibly damaging Het
Abca3 G A 17: 24,397,552 M989I probably benign Het
Acvr2b C T 9: 119,428,561 P220L probably damaging Het
Aqr T C 2: 114,156,277 D204G possibly damaging Het
Arpp19 G T 9: 75,056,734 D123Y probably damaging Het
Bod1l A G 5: 41,826,538 I554T probably damaging Het
Bpifa5 A G 2: 154,163,500 M1V probably null Het
Cdh3 T A 8: 106,537,063 probably null Het
Cep170 A T 1: 176,780,394 D165E possibly damaging Het
Cfap46 CCTTCTTCT CCTTCT 7: 139,638,900 probably benign Het
Cog3 A G 14: 75,719,712 L627P probably damaging Het
Col23a1 C T 11: 51,574,168 L453F probably damaging Het
Cyp2a22 T A 7: 26,934,232 Q351L probably benign Het
Ddx4 C A 13: 112,636,022 E78* probably null Het
Ddx4 T G 13: 112,636,023 K77N probably benign Het
Decr1 A T 4: 15,931,179 N92K probably benign Het
Dnm2 T C 9: 21,500,275 L600P probably damaging Het
Ece2 A C 16: 20,639,182 N356H probably damaging Het
Ern1 A T 11: 106,426,908 I130N possibly damaging Het
Fat2 G A 11: 55,296,271 R1250C probably damaging Het
Fat4 T A 3: 38,951,356 V1968D probably damaging Het
Frmd6 A G 12: 70,877,213 K82E probably damaging Het
Gm5431 A G 11: 48,894,999 V183A probably benign Het
Golgb1 T C 16: 36,915,622 S1744P possibly damaging Het
Hnrnpa3 C G 2: 75,662,570 Q213E possibly damaging Het
Hspa1a A G 17: 34,970,550 F459S probably damaging Het
Ice1 A G 13: 70,603,164 L1601P probably damaging Het
Igkv19-93 T A 6: 68,736,339 D102V probably damaging Het
Kansl1 G A 11: 104,357,526 T534I probably benign Het
Lpin2 T A 17: 71,231,269 S303R probably damaging Het
Lrpprc T A 17: 84,740,637 I845F probably benign Het
Mdn1 A G 4: 32,749,593 T4259A probably benign Het
Mtss1 A G 15: 58,943,719 I664T probably benign Het
Mum1 T A 10: 80,233,014 C331S probably benign Het
Myh8 A G 11: 67,301,967 E1528G probably benign Het
Myo5c A T 9: 75,245,037 E69V probably damaging Het
Myom3 A T 4: 135,785,892 D627V probably benign Het
Myom3 A G 4: 135,801,003 N1053S probably benign Het
Olfr1336 T C 7: 6,460,548 V13A probably benign Het
Olfr17 G A 7: 107,098,257 R264H possibly damaging Het
Olfr715b A T 7: 107,105,938 S308T probably benign Het
Phactr1 T A 13: 43,094,771 S399T probably benign Het
Ppp1r13b A G 12: 111,835,726 S278P probably benign Het
Prol1 A G 5: 88,327,877 Y42C probably damaging Het
Pum2 A G 12: 8,748,205 E906G probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rbp4 G A 19: 38,124,980 T30M probably benign Het
Selenbp1 T C 3: 94,943,846 L351P possibly damaging Het
Serpinb6b T C 13: 32,972,272 F115S probably damaging Het
Soga1 T C 2: 157,021,419 S1197G probably benign Het
Tigd3 A T 19: 5,892,842 Y87N probably damaging Het
Tigd5 T A 15: 75,911,022 L411H probably damaging Het
Ttc3 T C 16: 94,457,413 probably null Het
Uhmk1 T C 1: 170,199,880 Q416R probably damaging Het
Zfand4 T C 6: 116,273,614 F2L probably damaging Het
Zfhx3 C T 8: 108,955,388 T3153M possibly damaging Het
Zfp697 T G 3: 98,427,539 C207G possibly damaging Het
Zfp935 T C 13: 62,454,871 T172A probably benign Het
Znrf3 G T 11: 5,280,865 L883I probably benign Het
Other mutations in Plch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Plch2 APN 4 155006642 missense probably damaging 1.00
IGL02024:Plch2 APN 4 155043138 intron probably benign
IGL02580:Plch2 APN 4 154984764 missense probably benign 0.03
IGL03370:Plch2 APN 4 154986914 missense probably benign 0.18
IGL03407:Plch2 APN 4 154989798 missense probably damaging 1.00
tolerant UTSW 4 154984635 missense probably benign 0.01
PIT4418001:Plch2 UTSW 4 154989503 missense probably damaging 1.00
PIT4445001:Plch2 UTSW 4 155009026 missense probably damaging 1.00
R0117:Plch2 UTSW 4 154985358 unclassified probably benign
R0347:Plch2 UTSW 4 154986721 missense possibly damaging 0.91
R0361:Plch2 UTSW 4 155006711 missense possibly damaging 0.95
R0413:Plch2 UTSW 4 155006916 critical splice donor site probably null
R0487:Plch2 UTSW 4 155009012 missense probably damaging 1.00
R0514:Plch2 UTSW 4 154998886 missense probably damaging 1.00
R0734:Plch2 UTSW 4 154996283 missense probably damaging 1.00
R0766:Plch2 UTSW 4 154989799 missense probably damaging 1.00
R1306:Plch2 UTSW 4 155007140 missense probably damaging 1.00
R1312:Plch2 UTSW 4 154989799 missense probably damaging 1.00
R1467:Plch2 UTSW 4 154983732 missense probably benign 0.02
R1467:Plch2 UTSW 4 154983732 missense probably benign 0.02
R1602:Plch2 UTSW 4 154984450 missense probably damaging 0.99
R1717:Plch2 UTSW 4 154998272 missense probably benign
R1731:Plch2 UTSW 4 155006994 missense possibly damaging 0.83
R1769:Plch2 UTSW 4 155000083 missense probably damaging 1.00
R1875:Plch2 UTSW 4 154998508 missense probably damaging 1.00
R1974:Plch2 UTSW 4 154984953 missense possibly damaging 0.77
R2031:Plch2 UTSW 4 155043027 intron probably benign
R2050:Plch2 UTSW 4 155000818 missense probably benign 0.00
R2061:Plch2 UTSW 4 155042841 intron probably benign
R2073:Plch2 UTSW 4 154989909 missense probably damaging 1.00
R2075:Plch2 UTSW 4 154989909 missense probably damaging 1.00
R2109:Plch2 UTSW 4 154984597 missense possibly damaging 0.92
R2126:Plch2 UTSW 4 154998999 missense probably damaging 1.00
R2265:Plch2 UTSW 4 154993004 missense probably benign 0.06
R2266:Plch2 UTSW 4 154993004 missense probably benign 0.06
R2269:Plch2 UTSW 4 154993004 missense probably benign 0.06
R2280:Plch2 UTSW 4 154984309 missense probably damaging 1.00
R2281:Plch2 UTSW 4 154984309 missense probably damaging 1.00
R2432:Plch2 UTSW 4 154986164 makesense probably null
R2971:Plch2 UTSW 4 154990767 missense probably benign 0.29
R3437:Plch2 UTSW 4 154991013 critical splice donor site probably null
R3980:Plch2 UTSW 4 154984798 missense probably benign 0.00
R4757:Plch2 UTSW 4 154996233 missense possibly damaging 0.88
R4827:Plch2 UTSW 4 154991113 missense probably damaging 1.00
R4828:Plch2 UTSW 4 154984635 missense probably benign 0.01
R4869:Plch2 UTSW 4 154989428 missense probably benign 0.28
R5020:Plch2 UTSW 4 155007083 missense probably damaging 1.00
R5050:Plch2 UTSW 4 155043309 intron probably benign
R5126:Plch2 UTSW 4 155000519 missense probably damaging 1.00
R5237:Plch2 UTSW 4 155010794 missense probably benign
R5274:Plch2 UTSW 4 154998954 missense probably damaging 1.00
R5296:Plch2 UTSW 4 154989999 splice site probably null
R5324:Plch2 UTSW 4 154984534 missense probably benign
R5475:Plch2 UTSW 4 155000137 missense probably damaging 1.00
R5494:Plch2 UTSW 4 154991122 missense probably damaging 1.00
R5811:Plch2 UTSW 4 154992567 missense possibly damaging 0.62
R6083:Plch2 UTSW 4 155000818 missense probably benign 0.00
R6092:Plch2 UTSW 4 154984372 missense probably benign 0.02
R6456:Plch2 UTSW 4 154993002 missense probably damaging 1.00
R7038:Plch2 UTSW 4 154990032 splice site probably null
R7084:Plch2 UTSW 4 154986991 missense probably benign 0.31
R7210:Plch2 UTSW 4 155009086 missense probably damaging 1.00
R7216:Plch2 UTSW 4 154984228 missense probably benign
R7264:Plch2 UTSW 4 154998967 missense probably damaging 0.98
R7291:Plch2 UTSW 4 154998472 missense probably damaging 1.00
R7423:Plch2 UTSW 4 154983737 missense probably damaging 1.00
R7436:Plch2 UTSW 4 154984096 missense probably benign 0.01
R7438:Plch2 UTSW 4 155000460 missense probably damaging 1.00
R7594:Plch2 UTSW 4 155007027 missense probably damaging 1.00
R7663:Plch2 UTSW 4 154991162 missense probably damaging 0.96
R7698:Plch2 UTSW 4 155002787 missense possibly damaging 0.95
R7844:Plch2 UTSW 4 154989465 missense probably damaging 1.00
R7939:Plch2 UTSW 4 155002778 missense possibly damaging 0.91
R8003:Plch2 UTSW 4 155054523 missense unknown
R8007:Plch2 UTSW 4 155002831 missense probably damaging 1.00
R8281:Plch2 UTSW 4 155006973 missense probably benign 0.07
R8434:Plch2 UTSW 4 154989735 missense probably damaging 1.00
R8504:Plch2 UTSW 4 154984395 missense probably benign 0.31
R8516:Plch2 UTSW 4 154986307 missense probably benign
RF014:Plch2 UTSW 4 155007120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGATATTGGTCCCTGGTACG -3'
(R):5'- ATTAGGGGTCCCTCTGAGCATG -3'

Sequencing Primer
(F):5'- CTGGTACGCTGGCGACG -3'
(R):5'- GTTAAATTGAGGTATCAGCCATCGAG -3'
Posted On2018-03-15