Incidental Mutation 'R6253:Prol1'
ID506322
Institutional Source Beutler Lab
Gene Symbol Prol1
Ensembl Gene ENSMUSG00000064156
Gene Nameproline rich, lacrimal 1
SynonymsMuc10
MMRRC Submission 044370-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R6253 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location88317312-88328814 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88327877 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 42 (Y42C)
Ref Sequence ENSEMBL: ENSMUSP00000132678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170832]
Predicted Effect probably damaging
Transcript: ENSMUST00000170832
AA Change: Y42C

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132678
Gene: ENSMUSG00000064156
AA Change: Y42C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 40 52 N/A INTRINSIC
low complexity region 99 295 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,524,118 Y151H possibly damaging Het
Aasdh A G 5: 76,886,258 I482T possibly damaging Het
Abca3 G A 17: 24,397,552 M989I probably benign Het
Acvr2b C T 9: 119,428,561 P220L probably damaging Het
Aqr T C 2: 114,156,277 D204G possibly damaging Het
Arpp19 G T 9: 75,056,734 D123Y probably damaging Het
Bod1l A G 5: 41,826,538 I554T probably damaging Het
Bpifa5 A G 2: 154,163,500 M1V probably null Het
Cdh3 T A 8: 106,537,063 probably null Het
Cep170 A T 1: 176,780,394 D165E possibly damaging Het
Cfap46 CCTTCTTCT CCTTCT 7: 139,638,900 probably benign Het
Cog3 A G 14: 75,719,712 L627P probably damaging Het
Col23a1 C T 11: 51,574,168 L453F probably damaging Het
Cyp2a22 T A 7: 26,934,232 Q351L probably benign Het
Ddx4 C A 13: 112,636,022 E78* probably null Het
Ddx4 T G 13: 112,636,023 K77N probably benign Het
Decr1 A T 4: 15,931,179 N92K probably benign Het
Dnm2 T C 9: 21,500,275 L600P probably damaging Het
Ece2 A C 16: 20,639,182 N356H probably damaging Het
Ern1 A T 11: 106,426,908 I130N possibly damaging Het
Fat2 G A 11: 55,296,271 R1250C probably damaging Het
Fat4 T A 3: 38,951,356 V1968D probably damaging Het
Frmd6 A G 12: 70,877,213 K82E probably damaging Het
Gm5431 A G 11: 48,894,999 V183A probably benign Het
Golgb1 T C 16: 36,915,622 S1744P possibly damaging Het
Hnrnpa3 C G 2: 75,662,570 Q213E possibly damaging Het
Hspa1a A G 17: 34,970,550 F459S probably damaging Het
Ice1 A G 13: 70,603,164 L1601P probably damaging Het
Igkv19-93 T A 6: 68,736,339 D102V probably damaging Het
Kansl1 G A 11: 104,357,526 T534I probably benign Het
Lpin2 T A 17: 71,231,269 S303R probably damaging Het
Lrpprc T A 17: 84,740,637 I845F probably benign Het
Mdn1 A G 4: 32,749,593 T4259A probably benign Het
Mtss1 A G 15: 58,943,719 I664T probably benign Het
Mum1 T A 10: 80,233,014 C331S probably benign Het
Myh8 A G 11: 67,301,967 E1528G probably benign Het
Myo5c A T 9: 75,245,037 E69V probably damaging Het
Myom3 A T 4: 135,785,892 D627V probably benign Het
Myom3 A G 4: 135,801,003 N1053S probably benign Het
Olfr1336 T C 7: 6,460,548 V13A probably benign Het
Olfr17 G A 7: 107,098,257 R264H possibly damaging Het
Olfr715b A T 7: 107,105,938 S308T probably benign Het
Phactr1 T A 13: 43,094,771 S399T probably benign Het
Plch2 T A 4: 155,007,101 Y84F probably damaging Het
Ppp1r13b A G 12: 111,835,726 S278P probably benign Het
Pum2 A G 12: 8,748,205 E906G probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rbp4 G A 19: 38,124,980 T30M probably benign Het
Selenbp1 T C 3: 94,943,846 L351P possibly damaging Het
Serpinb6b T C 13: 32,972,272 F115S probably damaging Het
Soga1 T C 2: 157,021,419 S1197G probably benign Het
Tigd3 A T 19: 5,892,842 Y87N probably damaging Het
Tigd5 T A 15: 75,911,022 L411H probably damaging Het
Ttc3 T C 16: 94,457,413 probably null Het
Uhmk1 T C 1: 170,199,880 Q416R probably damaging Het
Zfand4 T C 6: 116,273,614 F2L probably damaging Het
Zfhx3 C T 8: 108,955,388 T3153M possibly damaging Het
Zfp697 T G 3: 98,427,539 C207G possibly damaging Het
Zfp935 T C 13: 62,454,871 T172A probably benign Het
Znrf3 G T 11: 5,280,865 L883I probably benign Het
Other mutations in Prol1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Prol1 APN 5 88327859 missense probably benign 0.31
IGL00500:Prol1 APN 5 88328691 makesense probably null
IGL01943:Prol1 APN 5 88327961 missense probably benign 0.03
IGL03291:Prol1 APN 5 88328520 missense unknown
R2144:Prol1 UTSW 5 88328395 missense unknown
R2888:Prol1 UTSW 5 88328309 missense unknown
R3849:Prol1 UTSW 5 88328617 missense unknown
R4078:Prol1 UTSW 5 88328216 missense unknown
R4079:Prol1 UTSW 5 88328216 missense unknown
R4166:Prol1 UTSW 5 88328671 missense unknown
R5447:Prol1 UTSW 5 88328266 missense unknown
R5709:Prol1 UTSW 5 88327852 nonsense probably null
R7804:Prol1 UTSW 5 88328405 missense unknown
Predicted Primers PCR Primer
(F):5'- AGAGGTGCTCAAAGTCTCCA -3'
(R):5'- TGCATTTGGTTTCGTTTTATCAGAGA -3'

Sequencing Primer
(F):5'- CCAAACATGTGATCAATGTGTGG -3'
(R):5'- CTGGAGGGCACATCTTAT -3'
Posted On2018-03-15