Incidental Mutation 'R6253:Prol1'
ID 506322
Institutional Source Beutler Lab
Gene Symbol Prol1
Ensembl Gene ENSMUSG00000064156
Gene Name proline rich, lacrimal 1
Synonyms Muc10
MMRRC Submission 044370-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R6253 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 88465171-88476673 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 88475736 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 42 (Y42C)
Ref Sequence ENSEMBL: ENSMUSP00000132678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170832]
AlphaFold E9PYQ4
Predicted Effect probably damaging
Transcript: ENSMUST00000170832
AA Change: Y42C

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132678
Gene: ENSMUSG00000064156
AA Change: Y42C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 40 52 N/A INTRINSIC
low complexity region 99 295 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,528,929 (GRCm39) Y151H possibly damaging Het
Aasdh A G 5: 77,034,105 (GRCm39) I482T possibly damaging Het
Abca3 G A 17: 24,616,526 (GRCm39) M989I probably benign Het
Acvr2b C T 9: 119,257,627 (GRCm39) P220L probably damaging Het
Aqr T C 2: 113,986,758 (GRCm39) D204G possibly damaging Het
Arpp19 G T 9: 74,964,016 (GRCm39) D123Y probably damaging Het
Bod1l A G 5: 41,983,881 (GRCm39) I554T probably damaging Het
Bpifa5 A G 2: 154,005,420 (GRCm39) M1V probably null Het
Cdh3 T A 8: 107,263,695 (GRCm39) probably null Het
Cep170 A T 1: 176,607,960 (GRCm39) D165E possibly damaging Het
Cfap46 CCTTCTTCT CCTTCT 7: 139,218,816 (GRCm39) probably benign Het
Cog3 A G 14: 75,957,152 (GRCm39) L627P probably damaging Het
Col23a1 C T 11: 51,464,995 (GRCm39) L453F probably damaging Het
Cyp2a22 T A 7: 26,633,657 (GRCm39) Q351L probably benign Het
Ddx4 T G 13: 112,772,557 (GRCm39) K77N probably benign Het
Ddx4 C A 13: 112,772,556 (GRCm39) E78* probably null Het
Decr1 A T 4: 15,931,179 (GRCm39) N92K probably benign Het
Dnm2 T C 9: 21,411,571 (GRCm39) L600P probably damaging Het
Ece2 A C 16: 20,457,932 (GRCm39) N356H probably damaging Het
Ern1 A T 11: 106,317,734 (GRCm39) I130N possibly damaging Het
Fat2 G A 11: 55,187,097 (GRCm39) R1250C probably damaging Het
Fat4 T A 3: 39,005,505 (GRCm39) V1968D probably damaging Het
Frmd6 A G 12: 70,923,987 (GRCm39) K82E probably damaging Het
Gm5431 A G 11: 48,785,826 (GRCm39) V183A probably benign Het
Golgb1 T C 16: 36,735,984 (GRCm39) S1744P possibly damaging Het
Hnrnpa3 C G 2: 75,492,914 (GRCm39) Q213E possibly damaging Het
Hspa1a A G 17: 35,189,526 (GRCm39) F459S probably damaging Het
Ice1 A G 13: 70,751,283 (GRCm39) L1601P probably damaging Het
Igkv19-93 T A 6: 68,713,323 (GRCm39) D102V probably damaging Het
Kansl1 G A 11: 104,248,352 (GRCm39) T534I probably benign Het
Lpin2 T A 17: 71,538,264 (GRCm39) S303R probably damaging Het
Lrpprc T A 17: 85,048,065 (GRCm39) I845F probably benign Het
Mdn1 A G 4: 32,749,593 (GRCm39) T4259A probably benign Het
Mtcl2 T C 2: 156,863,339 (GRCm39) S1197G probably benign Het
Mtss1 A G 15: 58,815,568 (GRCm39) I664T probably benign Het
Myh8 A G 11: 67,192,793 (GRCm39) E1528G probably benign Het
Myo5c A T 9: 75,152,319 (GRCm39) E69V probably damaging Het
Myom3 A T 4: 135,513,203 (GRCm39) D627V probably benign Het
Myom3 A G 4: 135,528,314 (GRCm39) N1053S probably benign Het
Or10a4 G A 7: 106,697,464 (GRCm39) R264H possibly damaging Het
Or2d2b A T 7: 106,705,145 (GRCm39) S308T probably benign Het
Or6z3 T C 7: 6,463,547 (GRCm39) V13A probably benign Het
Phactr1 T A 13: 43,248,247 (GRCm39) S399T probably benign Het
Plch2 T A 4: 155,091,558 (GRCm39) Y84F probably damaging Het
Ppp1r13b A G 12: 111,802,160 (GRCm39) S278P probably benign Het
Pum2 A G 12: 8,798,205 (GRCm39) E906G probably damaging Het
Pwwp3a T A 10: 80,068,848 (GRCm39) C331S probably benign Het
Rbp2 G T 9: 98,372,700 (GRCm39) S13I probably benign Het
Rbp4 G A 19: 38,113,428 (GRCm39) T30M probably benign Het
Selenbp1 T C 3: 94,851,157 (GRCm39) L351P possibly damaging Het
Serpinb6b T C 13: 33,156,255 (GRCm39) F115S probably damaging Het
Tigd3 A T 19: 5,942,870 (GRCm39) Y87N probably damaging Het
Tigd5 T A 15: 75,782,871 (GRCm39) L411H probably damaging Het
Ttc3 T C 16: 94,258,272 (GRCm39) probably null Het
Uhmk1 T C 1: 170,027,449 (GRCm39) Q416R probably damaging Het
Zfand4 T C 6: 116,250,575 (GRCm39) F2L probably damaging Het
Zfhx3 C T 8: 109,682,020 (GRCm39) T3153M possibly damaging Het
Zfp697 T G 3: 98,334,855 (GRCm39) C207G possibly damaging Het
Zfp935 T C 13: 62,602,685 (GRCm39) T172A probably benign Het
Znrf3 G T 11: 5,230,865 (GRCm39) L883I probably benign Het
Other mutations in Prol1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Prol1 APN 5 88,475,718 (GRCm39) missense probably benign 0.31
IGL00500:Prol1 APN 5 88,476,550 (GRCm39) makesense probably null
IGL01943:Prol1 APN 5 88,475,820 (GRCm39) missense probably benign 0.03
IGL03291:Prol1 APN 5 88,476,379 (GRCm39) missense unknown
R2144:Prol1 UTSW 5 88,476,254 (GRCm39) missense unknown
R2888:Prol1 UTSW 5 88,476,168 (GRCm39) missense unknown
R3849:Prol1 UTSW 5 88,476,476 (GRCm39) missense unknown
R4078:Prol1 UTSW 5 88,476,075 (GRCm39) missense unknown
R4079:Prol1 UTSW 5 88,476,075 (GRCm39) missense unknown
R4166:Prol1 UTSW 5 88,476,530 (GRCm39) missense unknown
R5447:Prol1 UTSW 5 88,476,125 (GRCm39) missense unknown
R5709:Prol1 UTSW 5 88,475,711 (GRCm39) nonsense probably null
R7804:Prol1 UTSW 5 88,476,264 (GRCm39) missense unknown
R7935:Prol1 UTSW 5 88,475,874 (GRCm39) missense probably damaging 0.97
R9697:Prol1 UTSW 5 88,466,426 (GRCm39) missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- AGAGGTGCTCAAAGTCTCCA -3'
(R):5'- TGCATTTGGTTTCGTTTTATCAGAGA -3'

Sequencing Primer
(F):5'- CCAAACATGTGATCAATGTGTGG -3'
(R):5'- CTGGAGGGCACATCTTAT -3'
Posted On 2018-03-15