Incidental Mutation 'R6253:Mum1'
ID506337
Institutional Source Beutler Lab
Gene Symbol Mum1
Ensembl Gene ENSMUSG00000020156
Gene Namemelanoma associated antigen (mutated) 1
Synonyms
MMRRC Submission 044370-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6253 (G1)
Quality Score221.009
Status Not validated
Chromosome10
Chromosomal Location80226434-80243903 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80233014 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 331 (C331S)
Ref Sequence ENSEMBL: ENSMUSP00000020365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020365] [ENSMUST00000130260]
Predicted Effect probably benign
Transcript: ENSMUST00000020365
AA Change: C331S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000020365
Gene: ENSMUSG00000020156
AA Change: C331S

DomainStartEndE-ValueType
low complexity region 127 140 N/A INTRINSIC
low complexity region 157 170 N/A INTRINSIC
Pfam:PWWP 381 458 2.9e-8 PFAM
low complexity region 671 682 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125784
Predicted Effect probably benign
Transcript: ENSMUST00000130260
SMART Domains Protein: ENSMUSP00000117519
Gene: ENSMUSG00000020156

DomainStartEndE-ValueType
low complexity region 127 140 N/A INTRINSIC
low complexity region 157 170 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135598
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139431
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146538
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,524,118 Y151H possibly damaging Het
Aasdh A G 5: 76,886,258 I482T possibly damaging Het
Abca3 G A 17: 24,397,552 M989I probably benign Het
Acvr2b C T 9: 119,428,561 P220L probably damaging Het
Aqr T C 2: 114,156,277 D204G possibly damaging Het
Arpp19 G T 9: 75,056,734 D123Y probably damaging Het
Bod1l A G 5: 41,826,538 I554T probably damaging Het
Bpifa5 A G 2: 154,163,500 M1V probably null Het
Cdh3 T A 8: 106,537,063 probably null Het
Cep170 A T 1: 176,780,394 D165E possibly damaging Het
Cfap46 CCTTCTTCT CCTTCT 7: 139,638,900 probably benign Het
Cog3 A G 14: 75,719,712 L627P probably damaging Het
Col23a1 C T 11: 51,574,168 L453F probably damaging Het
Cyp2a22 T A 7: 26,934,232 Q351L probably benign Het
Ddx4 C A 13: 112,636,022 E78* probably null Het
Ddx4 T G 13: 112,636,023 K77N probably benign Het
Decr1 A T 4: 15,931,179 N92K probably benign Het
Dnm2 T C 9: 21,500,275 L600P probably damaging Het
Ece2 A C 16: 20,639,182 N356H probably damaging Het
Ern1 A T 11: 106,426,908 I130N possibly damaging Het
Fat2 G A 11: 55,296,271 R1250C probably damaging Het
Fat4 T A 3: 38,951,356 V1968D probably damaging Het
Frmd6 A G 12: 70,877,213 K82E probably damaging Het
Gm5431 A G 11: 48,894,999 V183A probably benign Het
Golgb1 T C 16: 36,915,622 S1744P possibly damaging Het
Hnrnpa3 C G 2: 75,662,570 Q213E possibly damaging Het
Hspa1a A G 17: 34,970,550 F459S probably damaging Het
Ice1 A G 13: 70,603,164 L1601P probably damaging Het
Igkv19-93 T A 6: 68,736,339 D102V probably damaging Het
Kansl1 G A 11: 104,357,526 T534I probably benign Het
Lpin2 T A 17: 71,231,269 S303R probably damaging Het
Lrpprc T A 17: 84,740,637 I845F probably benign Het
Mdn1 A G 4: 32,749,593 T4259A probably benign Het
Mtss1 A G 15: 58,943,719 I664T probably benign Het
Myh8 A G 11: 67,301,967 E1528G probably benign Het
Myo5c A T 9: 75,245,037 E69V probably damaging Het
Myom3 A T 4: 135,785,892 D627V probably benign Het
Myom3 A G 4: 135,801,003 N1053S probably benign Het
Olfr1336 T C 7: 6,460,548 V13A probably benign Het
Olfr17 G A 7: 107,098,257 R264H possibly damaging Het
Olfr715b A T 7: 107,105,938 S308T probably benign Het
Phactr1 T A 13: 43,094,771 S399T probably benign Het
Plch2 T A 4: 155,007,101 Y84F probably damaging Het
Ppp1r13b A G 12: 111,835,726 S278P probably benign Het
Prol1 A G 5: 88,327,877 Y42C probably damaging Het
Pum2 A G 12: 8,748,205 E906G probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rbp4 G A 19: 38,124,980 T30M probably benign Het
Selenbp1 T C 3: 94,943,846 L351P possibly damaging Het
Serpinb6b T C 13: 32,972,272 F115S probably damaging Het
Soga1 T C 2: 157,021,419 S1197G probably benign Het
Tigd3 A T 19: 5,892,842 Y87N probably damaging Het
Tigd5 T A 15: 75,911,022 L411H probably damaging Het
Ttc3 T C 16: 94,457,413 probably null Het
Uhmk1 T C 1: 170,199,880 Q416R probably damaging Het
Zfand4 T C 6: 116,273,614 F2L probably damaging Het
Zfhx3 C T 8: 108,955,388 T3153M possibly damaging Het
Zfp697 T G 3: 98,427,539 C207G possibly damaging Het
Zfp935 T C 13: 62,454,871 T172A probably benign Het
Znrf3 G T 11: 5,280,865 L883I probably benign Het
Other mutations in Mum1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Mum1 APN 10 80234329 critical splice donor site probably null
IGL02152:Mum1 APN 10 80239978 missense probably damaging 1.00
IGL02541:Mum1 APN 10 80228439 critical splice donor site probably null
IGL02562:Mum1 APN 10 80238895 missense probably damaging 1.00
IGL02609:Mum1 APN 10 80230083 missense probably damaging 0.99
R0242:Mum1 UTSW 10 80234258 missense probably benign 0.02
R0242:Mum1 UTSW 10 80234258 missense probably benign 0.02
R0378:Mum1 UTSW 10 80238879 splice site probably null
R0441:Mum1 UTSW 10 80229025 missense probably damaging 1.00
R0675:Mum1 UTSW 10 80230080 missense probably damaging 0.99
R1558:Mum1 UTSW 10 80232944 missense probably benign 0.05
R1612:Mum1 UTSW 10 80233055 unclassified probably benign
R1873:Mum1 UTSW 10 80232608 missense possibly damaging 0.93
R2247:Mum1 UTSW 10 80240425 missense probably damaging 1.00
R3905:Mum1 UTSW 10 80238316 missense probably damaging 1.00
R3907:Mum1 UTSW 10 80238316 missense probably damaging 1.00
R3908:Mum1 UTSW 10 80238316 missense probably damaging 1.00
R4468:Mum1 UTSW 10 80240736 intron probably benign
R4657:Mum1 UTSW 10 80233014 missense probably benign 0.00
R4989:Mum1 UTSW 10 80232868 missense probably benign 0.01
R5030:Mum1 UTSW 10 80240375 intron probably benign
R5133:Mum1 UTSW 10 80232868 missense probably benign 0.01
R5134:Mum1 UTSW 10 80232868 missense probably benign 0.01
R5239:Mum1 UTSW 10 80228421 nonsense probably null
R6119:Mum1 UTSW 10 80229031 missense probably benign 0.25
R6526:Mum1 UTSW 10 80232279 missense probably benign 0.18
R7421:Mum1 UTSW 10 80232753 missense probably benign 0.38
R8116:Mum1 UTSW 10 80240397 missense probably damaging 1.00
R8252:Mum1 UTSW 10 80241860 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGTCATCAGGCAACATCAGGC -3'
(R):5'- TAGAAGTGCTTAGCAGGGATCCC -3'

Sequencing Primer
(F):5'- ACATCAGGCCACTCTCGG -3'
(R):5'- TGGGTCACCAGCTGCCTC -3'
Posted On2018-03-15