Incidental Mutation 'R6253:Phactr1'
ID506349
Institutional Source Beutler Lab
Gene Symbol Phactr1
Ensembl Gene ENSMUSG00000054728
Gene Namephosphatase and actin regulator 1
SynonymsRpel1, 9630030F18Rik
MMRRC Submission 044370-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6253 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location42680623-43138526 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43094771 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 399 (S399T)
Ref Sequence ENSEMBL: ENSMUSP00000115228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066928] [ENSMUST00000110161] [ENSMUST00000128646] [ENSMUST00000131942] [ENSMUST00000148891] [ENSMUST00000149235]
PDB Structure
Structure of the Phactr1 RPEL domain and RPEL motif directed assemblies with G-actin reveal the molecular basis for actin binding cooperativity. [X-RAY DIFFRACTION]
Structure of the Phactr1 RPEL-N domain bound to G-actin [X-RAY DIFFRACTION]
Structure of the Phactr1 RPEL-2 domain bound to actin [X-RAY DIFFRACTION]
Structure of the Phactr1 RPEL-2 bound to G-actin [X-RAY DIFFRACTION]
Structure of the Phactr1 RPEL-3 bound to G-actin [X-RAY DIFFRACTION]
Structure of the Phactr1 RPEL domain bound to G-actin [X-RAY DIFFRACTION]
Predicted Effect unknown
Transcript: ENSMUST00000066928
AA Change: S330T
SMART Domains Protein: ENSMUSP00000066663
Gene: ENSMUSG00000054728
AA Change: S330T

DomainStartEndE-ValueType
low complexity region 4 42 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 113 127 N/A INTRINSIC
RPEL 131 156 7.33e-5 SMART
low complexity region 170 188 N/A INTRINSIC
low complexity region 219 239 N/A INTRINSIC
low complexity region 252 269 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
low complexity region 388 399 N/A INTRINSIC
RPEL 415 440 1.23e-6 SMART
RPEL 453 478 5.14e-9 SMART
RPEL 491 516 2.71e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110161
AA Change: S406T

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000105790
Gene: ENSMUSG00000054728
AA Change: S406T

DomainStartEndE-ValueType
low complexity region 35 49 N/A INTRINSIC
low complexity region 50 68 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
RPEL 138 163 7.33e-5 SMART
low complexity region 177 195 N/A INTRINSIC
low complexity region 223 232 N/A INTRINSIC
low complexity region 295 315 N/A INTRINSIC
low complexity region 328 345 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
low complexity region 464 475 N/A INTRINSIC
RPEL 491 516 1.23e-6 SMART
RPEL 529 554 5.14e-9 SMART
RPEL 567 592 2.71e-8 SMART
Predicted Effect unknown
Transcript: ENSMUST00000128646
AA Change: S337T
SMART Domains Protein: ENSMUSP00000122232
Gene: ENSMUSG00000054728
AA Change: S337T

DomainStartEndE-ValueType
low complexity region 35 49 N/A INTRINSIC
low complexity region 50 68 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
RPEL 138 163 7.33e-5 SMART
low complexity region 177 195 N/A INTRINSIC
low complexity region 226 246 N/A INTRINSIC
low complexity region 259 276 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
RPEL 422 447 1.23e-6 SMART
RPEL 460 485 5.14e-9 SMART
RPEL 498 523 2.71e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131942
AA Change: S314T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000123346
Gene: ENSMUSG00000054728
AA Change: S314T

DomainStartEndE-ValueType
low complexity region 28 42 N/A INTRINSIC
RPEL 46 71 7.33e-5 SMART
low complexity region 85 103 N/A INTRINSIC
low complexity region 131 140 N/A INTRINSIC
low complexity region 203 223 N/A INTRINSIC
low complexity region 236 253 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
low complexity region 372 383 N/A INTRINSIC
RPEL 399 424 1.23e-6 SMART
RPEL 437 462 5.14e-9 SMART
RPEL 475 500 2.71e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148891
AA Change: S399T

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000115228
Gene: ENSMUSG00000054728
AA Change: S399T

DomainStartEndE-ValueType
low complexity region 4 42 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 113 127 N/A INTRINSIC
RPEL 131 156 7.33e-5 SMART
low complexity region 170 188 N/A INTRINSIC
low complexity region 216 225 N/A INTRINSIC
low complexity region 288 308 N/A INTRINSIC
low complexity region 321 338 N/A INTRINSIC
low complexity region 399 410 N/A INTRINSIC
low complexity region 457 468 N/A INTRINSIC
RPEL 484 509 1.23e-6 SMART
RPEL 522 547 5.14e-9 SMART
RPEL 560 585 2.71e-8 SMART
Predicted Effect unknown
Transcript: ENSMUST00000149235
AA Change: S337T
SMART Domains Protein: ENSMUSP00000115207
Gene: ENSMUSG00000054728
AA Change: S337T

DomainStartEndE-ValueType
low complexity region 35 49 N/A INTRINSIC
low complexity region 50 68 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
RPEL 138 163 7.33e-5 SMART
low complexity region 177 195 N/A INTRINSIC
low complexity region 226 246 N/A INTRINSIC
low complexity region 259 276 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
RPEL 422 447 1.23e-6 SMART
RPEL 460 485 5.14e-9 SMART
RPEL 498 523 2.71e-8 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the phosphatase and actin regulator family of proteins. This family member can bind actin and regulate the reorganization of the actin cytoskeleton. It plays a role in tubule formation and in endothelial cell survival. Polymorphisms in this gene are associated with susceptibility to myocardial infarction, coronary artery disease and cervical artery dissection. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,524,118 Y151H possibly damaging Het
Aasdh A G 5: 76,886,258 I482T possibly damaging Het
Abca3 G A 17: 24,397,552 M989I probably benign Het
Acvr2b C T 9: 119,428,561 P220L probably damaging Het
Aqr T C 2: 114,156,277 D204G possibly damaging Het
Arpp19 G T 9: 75,056,734 D123Y probably damaging Het
Bod1l A G 5: 41,826,538 I554T probably damaging Het
Bpifa5 A G 2: 154,163,500 M1V probably null Het
Cdh3 T A 8: 106,537,063 probably null Het
Cep170 A T 1: 176,780,394 D165E possibly damaging Het
Cfap46 CCTTCTTCT CCTTCT 7: 139,638,900 probably benign Het
Cog3 A G 14: 75,719,712 L627P probably damaging Het
Col23a1 C T 11: 51,574,168 L453F probably damaging Het
Cyp2a22 T A 7: 26,934,232 Q351L probably benign Het
Ddx4 C A 13: 112,636,022 E78* probably null Het
Ddx4 T G 13: 112,636,023 K77N probably benign Het
Decr1 A T 4: 15,931,179 N92K probably benign Het
Dnm2 T C 9: 21,500,275 L600P probably damaging Het
Ece2 A C 16: 20,639,182 N356H probably damaging Het
Ern1 A T 11: 106,426,908 I130N possibly damaging Het
Fat2 G A 11: 55,296,271 R1250C probably damaging Het
Fat4 T A 3: 38,951,356 V1968D probably damaging Het
Frmd6 A G 12: 70,877,213 K82E probably damaging Het
Gm5431 A G 11: 48,894,999 V183A probably benign Het
Golgb1 T C 16: 36,915,622 S1744P possibly damaging Het
Hnrnpa3 C G 2: 75,662,570 Q213E possibly damaging Het
Hspa1a A G 17: 34,970,550 F459S probably damaging Het
Ice1 A G 13: 70,603,164 L1601P probably damaging Het
Igkv19-93 T A 6: 68,736,339 D102V probably damaging Het
Kansl1 G A 11: 104,357,526 T534I probably benign Het
Lpin2 T A 17: 71,231,269 S303R probably damaging Het
Lrpprc T A 17: 84,740,637 I845F probably benign Het
Mdn1 A G 4: 32,749,593 T4259A probably benign Het
Mtss1 A G 15: 58,943,719 I664T probably benign Het
Mum1 T A 10: 80,233,014 C331S probably benign Het
Myh8 A G 11: 67,301,967 E1528G probably benign Het
Myo5c A T 9: 75,245,037 E69V probably damaging Het
Myom3 A T 4: 135,785,892 D627V probably benign Het
Myom3 A G 4: 135,801,003 N1053S probably benign Het
Olfr1336 T C 7: 6,460,548 V13A probably benign Het
Olfr17 G A 7: 107,098,257 R264H possibly damaging Het
Olfr715b A T 7: 107,105,938 S308T probably benign Het
Plch2 T A 4: 155,007,101 Y84F probably damaging Het
Ppp1r13b A G 12: 111,835,726 S278P probably benign Het
Prol1 A G 5: 88,327,877 Y42C probably damaging Het
Pum2 A G 12: 8,748,205 E906G probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rbp4 G A 19: 38,124,980 T30M probably benign Het
Selenbp1 T C 3: 94,943,846 L351P possibly damaging Het
Serpinb6b T C 13: 32,972,272 F115S probably damaging Het
Soga1 T C 2: 157,021,419 S1197G probably benign Het
Tigd3 A T 19: 5,892,842 Y87N probably damaging Het
Tigd5 T A 15: 75,911,022 L411H probably damaging Het
Ttc3 T C 16: 94,457,413 probably null Het
Uhmk1 T C 1: 170,199,880 Q416R probably damaging Het
Zfand4 T C 6: 116,273,614 F2L probably damaging Het
Zfhx3 C T 8: 108,955,388 T3153M possibly damaging Het
Zfp697 T G 3: 98,427,539 C207G possibly damaging Het
Zfp935 T C 13: 62,454,871 T172A probably benign Het
Znrf3 G T 11: 5,280,865 L883I probably benign Het
Other mutations in Phactr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Phactr1 APN 13 42956646 missense probably damaging 0.99
IGL01144:Phactr1 APN 13 43037524 missense possibly damaging 0.93
IGL02193:Phactr1 APN 13 42709700 splice site probably benign
IGL02691:Phactr1 APN 13 43077737 missense probably benign 0.38
R0028:Phactr1 UTSW 13 43057179 missense probably damaging 1.00
R0060:Phactr1 UTSW 13 42682721 nonsense probably null
R0522:Phactr1 UTSW 13 43059591 missense probably benign 0.00
R1354:Phactr1 UTSW 13 43057331 missense possibly damaging 0.91
R1382:Phactr1 UTSW 13 43132975 missense probably damaging 1.00
R1496:Phactr1 UTSW 13 43094990 missense probably damaging 0.98
R1620:Phactr1 UTSW 13 43094897 missense probably damaging 1.00
R1638:Phactr1 UTSW 13 42956671 missense probably damaging 1.00
R1679:Phactr1 UTSW 13 43057280 missense possibly damaging 0.65
R1679:Phactr1 UTSW 13 43094781 missense possibly damaging 0.94
R2055:Phactr1 UTSW 13 43077940 missense probably damaging 1.00
R2137:Phactr1 UTSW 13 43135175 missense possibly damaging 0.77
R2276:Phactr1 UTSW 13 43077789 missense possibly damaging 0.86
R2279:Phactr1 UTSW 13 43077789 missense possibly damaging 0.86
R3122:Phactr1 UTSW 13 43059573 missense possibly damaging 0.94
R4073:Phactr1 UTSW 13 43059769 intron probably benign
R4131:Phactr1 UTSW 13 43037477 missense probably damaging 0.99
R4237:Phactr1 UTSW 13 43094887 missense possibly damaging 0.94
R4238:Phactr1 UTSW 13 43094887 missense possibly damaging 0.94
R4239:Phactr1 UTSW 13 43094887 missense possibly damaging 0.94
R4240:Phactr1 UTSW 13 43094887 missense possibly damaging 0.94
R4507:Phactr1 UTSW 13 43096794 missense probably damaging 0.96
R4602:Phactr1 UTSW 13 43094965 missense probably benign 0.00
R4914:Phactr1 UTSW 13 43133963 missense possibly damaging 0.58
R5382:Phactr1 UTSW 13 43135219 utr 3 prime probably benign
R5882:Phactr1 UTSW 13 42709851 critical splice donor site probably null
R6451:Phactr1 UTSW 13 43132993 missense probably damaging 1.00
R6808:Phactr1 UTSW 13 43132969 missense probably damaging 1.00
R7061:Phactr1 UTSW 13 43132981 missense probably damaging 1.00
R7847:Phactr1 UTSW 13 43057188 missense possibly damaging 0.96
R7912:Phactr1 UTSW 13 42709763 missense probably benign 0.08
R7937:Phactr1 UTSW 13 43077729 missense unknown
R8344:Phactr1 UTSW 13 42709821 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TCTGTTTGGCTCCAGGCTAC -3'
(R):5'- CGTACTGGTGTACAAAGAGGCG -3'

Sequencing Primer
(F):5'- AGGCTACCGTCTCCACCAG -3'
(R):5'- GTGTACAAAGAGGCGTCATCATCTTC -3'
Posted On2018-03-15