Mutagenetix > Incidental Mutations

Incidental Mutation 'R6253:Ice1'

506351

Institutional Source

Beutler Lab

Gene Symbol

Ice1

Ensembl Gene

ENSMUSG00000034525

Gene Name

interactor of little elongation complex ELL subunit 1

Synonyms

BC018507

MMRRC Submission

044370-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.951) question?

Stock #

R6253 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

70551707-70637634 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 70603164 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 1601 (L1601P)

Ref Sequence

ENSEMBL: ENSMUSP00000036482 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043493] [ENSMUST00000220637] [ENSMUST00000222568]

AlphaFold

E9Q286

Predicted Effect

probably damaging
Transcript: ENSMUST00000043493
AA Change: L1601P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: L1601P

Domain	Start	End	E-Value	Type
coiled coil region	22	185	N/A	INTRINSIC
low complexity region	276	292	N/A	INTRINSIC
low complexity region	338	351	N/A	INTRINSIC
low complexity region	372	378	N/A	INTRINSIC
low complexity region	469	481	N/A	INTRINSIC
low complexity region	606	619	N/A	INTRINSIC
low complexity region	769	780	N/A	INTRINSIC
low complexity region	946	958	N/A	INTRINSIC
low complexity region	1061	1073	N/A	INTRINSIC
low complexity region	1329	1352	N/A	INTRINSIC
low complexity region	1595	1604	N/A	INTRINSIC
low complexity region	1656	1671	N/A	INTRINSIC
SCOP:d1gw5a_	2026	2223	5e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000220637

Predicted Effect

probably benign
Transcript: ENSMUST00000222568

Predicted Effect

probably benign
Transcript: ENSMUST00000222627

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921504E06Rik	A	G	2: 19,524,118	Y151H	possibly damaging	Het
Aasdh	A	G	5: 76,886,258	I482T	possibly damaging	Het
Abca3	G	A	17: 24,397,552	M989I	probably benign	Het
Acvr2b	C	T	9: 119,428,561	P220L	probably damaging	Het
Aqr	T	C	2: 114,156,277	D204G	possibly damaging	Het
Arpp19	G	T	9: 75,056,734	D123Y	probably damaging	Het
Bod1l	A	G	5: 41,826,538	I554T	probably damaging	Het
Bpifa5	A	G	2: 154,163,500	M1V	probably null	Het
Cdh3	T	A	8: 106,537,063		probably null	Het
Cep170	A	T	1: 176,780,394	D165E	possibly damaging	Het
Cfap46	CCTTCTTCT	CCTTCT	7: 139,638,900		probably benign	Het
Cog3	A	G	14: 75,719,712	L627P	probably damaging	Het
Col23a1	C	T	11: 51,574,168	L453F	probably damaging	Het
Cyp2a22	T	A	7: 26,934,232	Q351L	probably benign	Het
Ddx4	C	A	13: 112,636,022	E78*	probably null	Het
Ddx4	T	G	13: 112,636,023	K77N	probably benign	Het
Decr1	A	T	4: 15,931,179	N92K	probably benign	Het
Dnm2	T	C	9: 21,500,275	L600P	probably damaging	Het
Ece2	A	C	16: 20,639,182	N356H	probably damaging	Het
Ern1	A	T	11: 106,426,908	I130N	possibly damaging	Het
Fat2	G	A	11: 55,296,271	R1250C	probably damaging	Het
Fat4	T	A	3: 38,951,356	V1968D	probably damaging	Het
Frmd6	A	G	12: 70,877,213	K82E	probably damaging	Het
Gm5431	A	G	11: 48,894,999	V183A	probably benign	Het
Golgb1	T	C	16: 36,915,622	S1744P	possibly damaging	Het
Hnrnpa3	C	G	2: 75,662,570	Q213E	possibly damaging	Het
Hspa1a	A	G	17: 34,970,550	F459S	probably damaging	Het
Igkv19-93	T	A	6: 68,736,339	D102V	probably damaging	Het
Kansl1	G	A	11: 104,357,526	T534I	probably benign	Het
Lpin2	T	A	17: 71,231,269	S303R	probably damaging	Het
Lrpprc	T	A	17: 84,740,637	I845F	probably benign	Het
Mdn1	A	G	4: 32,749,593	T4259A	probably benign	Het
Mtss1	A	G	15: 58,943,719	I664T	probably benign	Het
Mum1	T	A	10: 80,233,014	C331S	probably benign	Het
Myh8	A	G	11: 67,301,967	E1528G	probably benign	Het
Myo5c	A	T	9: 75,245,037	E69V	probably damaging	Het
Myom3	A	T	4: 135,785,892	D627V	probably benign	Het
Myom3	A	G	4: 135,801,003	N1053S	probably benign	Het
Olfr1336	T	C	7: 6,460,548	V13A	probably benign	Het
Olfr17	G	A	7: 107,098,257	R264H	possibly damaging	Het
Olfr715b	A	T	7: 107,105,938	S308T	probably benign	Het
Phactr1	T	A	13: 43,094,771	S399T	probably benign	Het
Plch2	T	A	4: 155,007,101	Y84F	probably damaging	Het
Ppp1r13b	A	G	12: 111,835,726	S278P	probably benign	Het
Prol1	A	G	5: 88,327,877	Y42C	probably damaging	Het
Pum2	A	G	12: 8,748,205	E906G	probably damaging	Het
Rbp2	G	T	9: 98,490,647	S13I	probably benign	Het
Rbp4	G	A	19: 38,124,980	T30M	probably benign	Het
Selenbp1	T	C	3: 94,943,846	L351P	possibly damaging	Het
Serpinb6b	T	C	13: 32,972,272	F115S	probably damaging	Het
Soga1	T	C	2: 157,021,419	S1197G	probably benign	Het
Tigd3	A	T	19: 5,892,842	Y87N	probably damaging	Het
Tigd5	T	A	15: 75,911,022	L411H	probably damaging	Het
Ttc3	T	C	16: 94,457,413		probably null	Het
Uhmk1	T	C	1: 170,199,880	Q416R	probably damaging	Het
Zfand4	T	C	6: 116,273,614	F2L	probably damaging	Het
Zfhx3	C	T	8: 108,955,388	T3153M	possibly damaging	Het
Zfp697	T	G	3: 98,427,539	C207G	possibly damaging	Het
Zfp935	T	C	13: 62,454,871	T172A	probably benign	Het
Znrf3	G	T	11: 5,280,865	L883I	probably benign	Het

Other mutations in Ice1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00904:Ice1	APN	13	70602289	missense	probably damaging	1.00
IGL01155:Ice1	APN	13	70604082	missense	possibly damaging	0.93
IGL01298:Ice1	APN	13	70604904	missense	possibly damaging	0.93
IGL01797:Ice1	APN	13	70623946	missense	probably damaging	1.00
IGL02423:Ice1	APN	13	70592599	missense	probably damaging	1.00
IGL02583:Ice1	APN	13	70605735	missense	possibly damaging	0.80
IGL02794:Ice1	APN	13	70609159	missense	possibly damaging	0.95
IGL02882:Ice1	APN	13	70624474	splice site	probably benign
IGL02929:Ice1	APN	13	70596203	missense	probably damaging	1.00
IGL03343:Ice1	APN	13	70602929	missense	probably damaging	1.00
IGL03384:Ice1	APN	13	70603249	missense	probably benign	0.00
PIT4651001:Ice1	UTSW	13	70623921	critical splice donor site	probably null
R0078:Ice1	UTSW	13	70603348	missense	probably damaging	0.98
R0081:Ice1	UTSW	13	70619044	nonsense	probably null
R0281:Ice1	UTSW	13	70604047	missense	possibly damaging	0.64
R0557:Ice1	UTSW	13	70601191	missense	probably benign	0.08
R0973:Ice1	UTSW	13	70602427	missense	probably benign	0.04
R0973:Ice1	UTSW	13	70602427	missense	probably benign	0.04
R0974:Ice1	UTSW	13	70602427	missense	probably benign	0.04
R1033:Ice1	UTSW	13	70606594	missense	probably damaging	0.96
R1371:Ice1	UTSW	13	70596221	missense	probably damaging	1.00
R1525:Ice1	UTSW	13	70605410	missense	probably benign	0.01
R1539:Ice1	UTSW	13	70605904	missense	probably damaging	1.00
R1596:Ice1	UTSW	13	70604895	missense	possibly damaging	0.94
R1603:Ice1	UTSW	13	70603353	missense	probably benign	0.01
R1680:Ice1	UTSW	13	70605448	missense	probably benign	0.00
R1737:Ice1	UTSW	13	70606325	missense	probably damaging	0.99
R1766:Ice1	UTSW	13	70604442	missense	possibly damaging	0.78
R1774:Ice1	UTSW	13	70604553	missense	probably damaging	1.00
R1834:Ice1	UTSW	13	70615338	missense	probably damaging	0.99
R1840:Ice1	UTSW	13	70606218	missense	probably benign	0.00
R1898:Ice1	UTSW	13	70602307	missense	possibly damaging	0.83
R1930:Ice1	UTSW	13	70605083	missense	probably benign	0.18
R2000:Ice1	UTSW	13	70602427	missense	possibly damaging	0.58
R2106:Ice1	UTSW	13	70605622	missense	probably benign	0.00
R2293:Ice1	UTSW	13	70614957	missense	probably damaging	1.00
R2377:Ice1	UTSW	13	70602780	missense	probably damaging	1.00
R2909:Ice1	UTSW	13	70596173	missense	probably damaging	1.00
R2965:Ice1	UTSW	13	70602578	missense	probably benign	0.31
R3730:Ice1	UTSW	13	70603240	missense	probably damaging	1.00
R3886:Ice1	UTSW	13	70605370	missense	probably benign	0.00
R3914:Ice1	UTSW	13	70606084	missense	probably benign	0.30
R4051:Ice1	UTSW	13	70603527	missense	probably damaging	1.00
R4321:Ice1	UTSW	13	70603110	missense	possibly damaging	0.83
R4499:Ice1	UTSW	13	70609027	missense	possibly damaging	0.87
R4729:Ice1	UTSW	13	70606384	missense	probably damaging	1.00
R5078:Ice1	UTSW	13	70604850	missense	probably benign
R5431:Ice1	UTSW	13	70592650	missense	probably damaging	1.00
R5722:Ice1	UTSW	13	70615100	missense	possibly damaging	0.95
R5881:Ice1	UTSW	13	70606501	missense	probably benign	0.04
R5914:Ice1	UTSW	13	70606377	missense	possibly damaging	0.93
R6171:Ice1	UTSW	13	70606731	missense	probably benign
R6274:Ice1	UTSW	13	70594839	missense	probably damaging	0.97
R6518:Ice1	UTSW	13	70606309	missense	possibly damaging	0.89
R6665:Ice1	UTSW	13	70603473	missense	possibly damaging	0.85
R6714:Ice1	UTSW	13	70615263	splice site	probably null
R6853:Ice1	UTSW	13	70603302	missense	possibly damaging	0.92
R6917:Ice1	UTSW	13	70594894	missense	probably damaging	1.00
R7032:Ice1	UTSW	13	70596164	missense	probably damaging	0.99
R7176:Ice1	UTSW	13	70624406	critical splice donor site	probably null
R7352:Ice1	UTSW	13	70606102	nonsense	probably null
R7445:Ice1	UTSW	13	70596167	missense
R7646:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7647:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7648:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7650:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7650:Ice1	UTSW	13	70605483	missense	probably damaging	1.00
R7812:Ice1	UTSW	13	70603005	missense	possibly damaging	0.63
R8061:Ice1	UTSW	13	70603732	missense	probably damaging	1.00
R8129:Ice1	UTSW	13	70606201	missense	probably benign	0.02
R8283:Ice1	UTSW	13	70604430	missense	probably damaging	0.97
R8303:Ice1	UTSW	13	70606407	missense	probably benign	0.04
R8444:Ice1	UTSW	13	70604376	missense	probably damaging	1.00
R8474:Ice1	UTSW	13	70604447	missense	probably benign	0.42
R8751:Ice1	UTSW	13	70602891	missense	probably damaging	1.00
R8887:Ice1	UTSW	13	70602931	missense	probably damaging	1.00
R8911:Ice1	UTSW	13	70592668	missense
R8954:Ice1	UTSW	13	70610578	missense	probably damaging	1.00
R9345:Ice1	UTSW	13	70592639	missense
R9438:Ice1	UTSW	13	70606315	missense	probably benign	0.04
X0026:Ice1	UTSW	13	70592602	missense	probably damaging	1.00
Z1176:Ice1	UTSW	13	70605201	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAACGGAGAGGACACTATC -3'
(R):5'- AATGAAGTCCCTCAGCCAGC -3'

Sequencing Primer
(F):5'- GGACACTATCCTTCCACTAGCTG -3'
(R):5'- CCAGCCTCAGGGGAAGGAAC -3'

Posted On

2018-03-15