Incidental Mutation 'R6253:Ddx4'
ID506353
Institutional Source Beutler Lab
Gene Symbol Ddx4
Ensembl Gene ENSMUSG00000021758
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 4
SynonymsMvh, VASA, mvh / m'vasa
MMRRC Submission 044370-MU
Accession Numbers

Genbank: NM_001145885, NM_010029

Is this an essential gene? Possibly essential (E-score: 0.682) question?
Stock #R6253 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location112598333-112652475 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 112636023 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 77 (K77N)
Ref Sequence ENSEMBL: ENSMUSP00000096769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075748] [ENSMUST00000099166]
Predicted Effect probably benign
Transcript: ENSMUST00000075748
AA Change: K51N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075157
Gene: ENSMUSG00000021758
AA Change: K51N

DomainStartEndE-ValueType
Blast:DEXDc 22 165 8e-14 BLAST
low complexity region 175 183 N/A INTRINSIC
low complexity region 221 229 N/A INTRINSIC
DEXDc 280 491 9.38e-59 SMART
HELICc 527 608 1.18e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099166
AA Change: K77N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000096769
Gene: ENSMUSG00000021758
AA Change: K77N

DomainStartEndE-ValueType
Blast:DEXDc 41 191 7e-25 BLAST
low complexity region 201 209 N/A INTRINSIC
low complexity region 247 255 N/A INTRINSIC
DEXDc 306 517 9.38e-59 SMART
HELICc 553 634 1.18e-32 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a homolog of VASA proteins in Drosophila and several other species. The gene is specifically expressed in the germ cell lineage in both sexes and functions in germ cell development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Spermatogenesis is blocked in homozygous mutant mice, resulting in male infertility. Female mutant mice are fertile and do not exhibit any obvious reproductive defects. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, other(3) Gene trapped(2)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,524,118 Y151H possibly damaging Het
Aasdh A G 5: 76,886,258 I482T possibly damaging Het
Abca3 G A 17: 24,397,552 M989I probably benign Het
Acvr2b C T 9: 119,428,561 P220L probably damaging Het
Aqr T C 2: 114,156,277 D204G possibly damaging Het
Arpp19 G T 9: 75,056,734 D123Y probably damaging Het
Bod1l A G 5: 41,826,538 I554T probably damaging Het
Bpifa5 A G 2: 154,163,500 M1V probably null Het
Cdh3 T A 8: 106,537,063 probably null Het
Cep170 A T 1: 176,780,394 D165E possibly damaging Het
Cfap46 CCTTCTTCT CCTTCT 7: 139,638,900 probably benign Het
Cog3 A G 14: 75,719,712 L627P probably damaging Het
Col23a1 C T 11: 51,574,168 L453F probably damaging Het
Cyp2a22 T A 7: 26,934,232 Q351L probably benign Het
Decr1 A T 4: 15,931,179 N92K probably benign Het
Dnm2 T C 9: 21,500,275 L600P probably damaging Het
Ece2 A C 16: 20,639,182 N356H probably damaging Het
Ern1 A T 11: 106,426,908 I130N possibly damaging Het
Fat2 G A 11: 55,296,271 R1250C probably damaging Het
Fat4 T A 3: 38,951,356 V1968D probably damaging Het
Frmd6 A G 12: 70,877,213 K82E probably damaging Het
Gm5431 A G 11: 48,894,999 V183A probably benign Het
Golgb1 T C 16: 36,915,622 S1744P possibly damaging Het
Hnrnpa3 C G 2: 75,662,570 Q213E possibly damaging Het
Hspa1a A G 17: 34,970,550 F459S probably damaging Het
Ice1 A G 13: 70,603,164 L1601P probably damaging Het
Igkv19-93 T A 6: 68,736,339 D102V probably damaging Het
Kansl1 G A 11: 104,357,526 T534I probably benign Het
Lpin2 T A 17: 71,231,269 S303R probably damaging Het
Lrpprc T A 17: 84,740,637 I845F probably benign Het
Mdn1 A G 4: 32,749,593 T4259A probably benign Het
Mtss1 A G 15: 58,943,719 I664T probably benign Het
Mum1 T A 10: 80,233,014 C331S probably benign Het
Myh8 A G 11: 67,301,967 E1528G probably benign Het
Myo5c A T 9: 75,245,037 E69V probably damaging Het
Myom3 A T 4: 135,785,892 D627V probably benign Het
Myom3 A G 4: 135,801,003 N1053S probably benign Het
Olfr1336 T C 7: 6,460,548 V13A probably benign Het
Olfr17 G A 7: 107,098,257 R264H possibly damaging Het
Olfr715b A T 7: 107,105,938 S308T probably benign Het
Phactr1 T A 13: 43,094,771 S399T probably benign Het
Plch2 T A 4: 155,007,101 Y84F probably damaging Het
Ppp1r13b A G 12: 111,835,726 S278P probably benign Het
Prol1 A G 5: 88,327,877 Y42C probably damaging Het
Pum2 A G 12: 8,748,205 E906G probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rbp4 G A 19: 38,124,980 T30M probably benign Het
Selenbp1 T C 3: 94,943,846 L351P possibly damaging Het
Serpinb6b T C 13: 32,972,272 F115S probably damaging Het
Soga1 T C 2: 157,021,419 S1197G probably benign Het
Tigd3 A T 19: 5,892,842 Y87N probably damaging Het
Tigd5 T A 15: 75,911,022 L411H probably damaging Het
Ttc3 T C 16: 94,457,413 probably null Het
Uhmk1 T C 1: 170,199,880 Q416R probably damaging Het
Zfand4 T C 6: 116,273,614 F2L probably damaging Het
Zfhx3 C T 8: 108,955,388 T3153M possibly damaging Het
Zfp697 T G 3: 98,427,539 C207G possibly damaging Het
Zfp935 T C 13: 62,454,871 T172A probably benign Het
Znrf3 G T 11: 5,280,865 L883I probably benign Het
Other mutations in Ddx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02030:Ddx4 APN 13 112624777 splice site probably benign
IGL02682:Ddx4 APN 13 112622186 missense probably benign 0.04
IGL02729:Ddx4 APN 13 112651412 utr 5 prime probably benign
H8930:Ddx4 UTSW 13 112613833 splice site probably null
R0518:Ddx4 UTSW 13 112624779 critical splice donor site probably null
R0521:Ddx4 UTSW 13 112624779 critical splice donor site probably null
R1527:Ddx4 UTSW 13 112622239 missense possibly damaging 0.95
R1548:Ddx4 UTSW 13 112599997 missense probably damaging 1.00
R1773:Ddx4 UTSW 13 112599902 missense probably benign
R1886:Ddx4 UTSW 13 112622665 missense probably damaging 1.00
R1969:Ddx4 UTSW 13 112600013 missense probably damaging 0.99
R1969:Ddx4 UTSW 13 112620742 missense probably damaging 0.99
R1970:Ddx4 UTSW 13 112600013 missense probably damaging 0.99
R1971:Ddx4 UTSW 13 112600013 missense probably damaging 0.99
R2265:Ddx4 UTSW 13 112621276 missense probably benign 0.08
R2280:Ddx4 UTSW 13 112620656 missense probably benign 0.03
R2846:Ddx4 UTSW 13 112604612 missense probably damaging 0.99
R2906:Ddx4 UTSW 13 112620777 splice site probably benign
R2980:Ddx4 UTSW 13 112612085 missense probably damaging 1.00
R3732:Ddx4 UTSW 13 112611982 missense possibly damaging 0.56
R4085:Ddx4 UTSW 13 112613761 missense probably benign 0.05
R4088:Ddx4 UTSW 13 112613761 missense probably benign 0.05
R4089:Ddx4 UTSW 13 112613761 missense probably benign 0.05
R4090:Ddx4 UTSW 13 112613761 missense probably benign 0.05
R4600:Ddx4 UTSW 13 112612060 missense probably damaging 1.00
R4610:Ddx4 UTSW 13 112612060 missense probably damaging 1.00
R4669:Ddx4 UTSW 13 112622244 missense probably damaging 1.00
R4700:Ddx4 UTSW 13 112613735 missense probably damaging 1.00
R4782:Ddx4 UTSW 13 112613696 critical splice donor site probably null
R4782:Ddx4 UTSW 13 112651360 missense probably benign 0.10
R5326:Ddx4 UTSW 13 112621245 missense probably damaging 1.00
R5542:Ddx4 UTSW 13 112621245 missense probably damaging 1.00
R6111:Ddx4 UTSW 13 112621232 nonsense probably null
R6253:Ddx4 UTSW 13 112636022 nonsense probably null
R6286:Ddx4 UTSW 13 112613735 missense probably damaging 1.00
R6518:Ddx4 UTSW 13 112604547 missense probably benign
R6645:Ddx4 UTSW 13 112641174 missense possibly damaging 0.70
R7017:Ddx4 UTSW 13 112601488 missense probably damaging 1.00
R7155:Ddx4 UTSW 13 112613785 missense probably benign 0.01
R7822:Ddx4 UTSW 13 112612113 missense probably damaging 1.00
R8041:Ddx4 UTSW 13 112626394 missense probably benign
R8048:Ddx4 UTSW 13 112622172 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GCCTCATGATTTCTACATGGC -3'
(R):5'- TCCTGTGGGCTGAATATAATGC -3'

Sequencing Primer
(F):5'- TGGCACACACTTTCTGTG -3'
(R):5'- TTGAGGCAAGGGGGATTTAGTAC -3'
Posted On2018-03-15