Mutagenetix > Incidental Mutation

Incidental Mutation 'R6253:Lrpprc'

506363

Institutional Source

Beutler Lab

Gene Symbol

Lrpprc

Ensembl Gene

ENSMUSG00000024120

Gene Name

leucine-rich PPR-motif containing

Synonyms

3110001K13Rik, Lrp130

MMRRC Submission

044370-MU

Accession Numbers

Ncbi RefSeq: NM_028233.2; MGI:1919666

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6253 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

84705247-84790789 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 84740637 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 845 (I845F)

Ref Sequence

ENSEMBL: ENSMUSP00000107927 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112308]

AlphaFold

Q6PB66

Predicted Effect

probably benign
Transcript: ENSMUST00000112308
AA Change: I845F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000107927
Gene: ENSMUSG00000024120
AA Change: I845F

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	32	50	N/A	INTRINSIC
low complexity region	123	136	N/A	INTRINSIC
Pfam:PPR_3	196	228	9.1e-4	PFAM
Pfam:PPR	197	227	2.3e-4	PFAM
Pfam:PPR_3	231	264	7.9e-6	PFAM
Pfam:PPR	232	262	4e-4	PFAM
Pfam:PPR_3	266	297	9.7e-3	PFAM
internal_repeat_2	391	477	3.13e-7	PROSPERO
Pfam:PPR	750	778	3.4e-4	PFAM
low complexity region	1017	1028	N/A	INTRINSIC
internal_repeat_1	1042	1362	1.09e-11	PROSPERO
low complexity region	1366	1375	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000160011

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.1%

Validation Efficiency

MGI Phenotype

Strain: 3857306; 5438913
Lethality: E10-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a leucine-rich protein that has multiple pentatricopeptide repeats (PPR). The precise role of this protein is unknown but studies suggest it may play a role in cytoskeletal organization, vesicular transport, or in transcriptional regulation of both nuclear and mitochondrial genes. The protein localizes primarily to mitochondria and is predicted to have an N-terminal mitochondrial targeting sequence. Mutations in this gene are associated with the French-Canadian type of Leigh syndrome. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality during organogenesis associated with growth retardation. Mice homozygous for a knock-out allele exhibit embryonic lethality between somite formation and embryo turning. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted(3) Gene trapped(10)

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921504E06Rik	A	G	2: 19,524,118	Y151H	possibly damaging	Het
Aasdh	A	G	5: 76,886,258	I482T	possibly damaging	Het
Abca3	G	A	17: 24,397,552	M989I	probably benign	Het
Acvr2b	C	T	9: 119,428,561	P220L	probably damaging	Het
Aqr	T	C	2: 114,156,277	D204G	possibly damaging	Het
Arpp19	G	T	9: 75,056,734	D123Y	probably damaging	Het
Bod1l	A	G	5: 41,826,538	I554T	probably damaging	Het
Bpifa5	A	G	2: 154,163,500	M1V	probably null	Het
Cdh3	T	A	8: 106,537,063		probably null	Het
Cep170	A	T	1: 176,780,394	D165E	possibly damaging	Het
Cfap46	CCTTCTTCT	CCTTCT	7: 139,638,900		probably benign	Het
Cog3	A	G	14: 75,719,712	L627P	probably damaging	Het
Col23a1	C	T	11: 51,574,168	L453F	probably damaging	Het
Cyp2a22	T	A	7: 26,934,232	Q351L	probably benign	Het
Ddx4	C	A	13: 112,636,022	E78*	probably null	Het
Ddx4	T	G	13: 112,636,023	K77N	probably benign	Het
Decr1	A	T	4: 15,931,179	N92K	probably benign	Het
Dnm2	T	C	9: 21,500,275	L600P	probably damaging	Het
Ece2	A	C	16: 20,639,182	N356H	probably damaging	Het
Ern1	A	T	11: 106,426,908	I130N	possibly damaging	Het
Fat2	G	A	11: 55,296,271	R1250C	probably damaging	Het
Fat4	T	A	3: 38,951,356	V1968D	probably damaging	Het
Frmd6	A	G	12: 70,877,213	K82E	probably damaging	Het
Gm5431	A	G	11: 48,894,999	V183A	probably benign	Het
Golgb1	T	C	16: 36,915,622	S1744P	possibly damaging	Het
Hnrnpa3	C	G	2: 75,662,570	Q213E	possibly damaging	Het
Hspa1a	A	G	17: 34,970,550	F459S	probably damaging	Het
Ice1	A	G	13: 70,603,164	L1601P	probably damaging	Het
Igkv19-93	T	A	6: 68,736,339	D102V	probably damaging	Het
Kansl1	G	A	11: 104,357,526	T534I	probably benign	Het
Lpin2	T	A	17: 71,231,269	S303R	probably damaging	Het
Mdn1	A	G	4: 32,749,593	T4259A	probably benign	Het
Mtss1	A	G	15: 58,943,719	I664T	probably benign	Het
Mum1	T	A	10: 80,233,014	C331S	probably benign	Het
Myh8	A	G	11: 67,301,967	E1528G	probably benign	Het
Myo5c	A	T	9: 75,245,037	E69V	probably damaging	Het
Myom3	A	T	4: 135,785,892	D627V	probably benign	Het
Myom3	A	G	4: 135,801,003	N1053S	probably benign	Het
Olfr1336	T	C	7: 6,460,548	V13A	probably benign	Het
Olfr17	G	A	7: 107,098,257	R264H	possibly damaging	Het
Olfr715b	A	T	7: 107,105,938	S308T	probably benign	Het
Phactr1	T	A	13: 43,094,771	S399T	probably benign	Het
Plch2	T	A	4: 155,007,101	Y84F	probably damaging	Het
Ppp1r13b	A	G	12: 111,835,726	S278P	probably benign	Het
Prol1	A	G	5: 88,327,877	Y42C	probably damaging	Het
Pum2	A	G	12: 8,748,205	E906G	probably damaging	Het
Rbp2	G	T	9: 98,490,647	S13I	probably benign	Het
Rbp4	G	A	19: 38,124,980	T30M	probably benign	Het
Selenbp1	T	C	3: 94,943,846	L351P	possibly damaging	Het
Serpinb6b	T	C	13: 32,972,272	F115S	probably damaging	Het
Soga1	T	C	2: 157,021,419	S1197G	probably benign	Het
Tigd3	A	T	19: 5,892,842	Y87N	probably damaging	Het
Tigd5	T	A	15: 75,911,022	L411H	probably damaging	Het
Ttc3	T	C	16: 94,457,413		probably null	Het
Uhmk1	T	C	1: 170,199,880	Q416R	probably damaging	Het
Zfand4	T	C	6: 116,273,614	F2L	probably damaging	Het
Zfhx3	C	T	8: 108,955,388	T3153M	possibly damaging	Het
Zfp697	T	G	3: 98,427,539	C207G	possibly damaging	Het
Zfp935	T	C	13: 62,454,871	T172A	probably benign	Het
Znrf3	G	T	11: 5,280,865	L883I	probably benign	Het

Other mutations in Lrpprc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Lrpprc	APN	17	84750525	missense	possibly damaging	0.91
IGL01319:Lrpprc	APN	17	84705412	utr 3 prime	probably benign
IGL01380:Lrpprc	APN	17	84722730	missense	probably benign
IGL01560:Lrpprc	APN	17	84708119	missense	probably benign	0.07
IGL01582:Lrpprc	APN	17	84754543	missense	probably null	0.00
IGL01996:Lrpprc	APN	17	84773270	missense	probably benign
IGL02109:Lrpprc	APN	17	84726570	nonsense	probably null
IGL02163:Lrpprc	APN	17	84753472	missense	probably damaging	0.97
IGL02248:Lrpprc	APN	17	84771467	missense	probably damaging	0.99
IGL02503:Lrpprc	APN	17	84726339	missense	probably benign
IGL02545:Lrpprc	APN	17	84775425	missense	probably benign
IGL02570:Lrpprc	APN	17	84750553	missense	probably damaging	1.00
IGL02636:Lrpprc	APN	17	84753104	unclassified	probably benign
IGL02943:Lrpprc	APN	17	84771450	missense	probably benign	0.00
IGL03008:Lrpprc	APN	17	84751247	missense	probably benign	0.05
elusory	UTSW	17	84712787	missense	probably benign	0.01
phantom	UTSW	17	84772147	missense	probably damaging	1.00
R6807_Lrpprc_629	UTSW	17	84749103	missense	possibly damaging	0.93
Stereotype	UTSW	17	84767055	missense	probably damaging	1.00
thus	UTSW	17	84770927	missense	probably benign	0.01
P0023:Lrpprc	UTSW	17	84726338	missense	probably benign	0.00
R0027:Lrpprc	UTSW	17	84767007	nonsense	probably null
R0027:Lrpprc	UTSW	17	84767007	nonsense	probably null
R0302:Lrpprc	UTSW	17	84740078	missense	possibly damaging	0.76
R0389:Lrpprc	UTSW	17	84753112	critical splice donor site	probably null
R0448:Lrpprc	UTSW	17	84770894	missense	probably benign	0.09
R1396:Lrpprc	UTSW	17	84726303	missense	possibly damaging	0.68
R1759:Lrpprc	UTSW	17	84740081	missense	probably damaging	1.00
R2019:Lrpprc	UTSW	17	84752331	missense	possibly damaging	0.56
R2169:Lrpprc	UTSW	17	84770077	missense	probably benign	0.00
R2312:Lrpprc	UTSW	17	84773258	missense	probably damaging	0.96
R2319:Lrpprc	UTSW	17	84726390	missense	probably benign
R2568:Lrpprc	UTSW	17	84726649	missense	probably damaging	1.00
R3013:Lrpprc	UTSW	17	84767069	missense	probably benign	0.04
R3620:Lrpprc	UTSW	17	84770024	missense	probably benign	0.01
R3789:Lrpprc	UTSW	17	84771528	missense	probably benign	0.25
R3848:Lrpprc	UTSW	17	84770927	missense	probably benign	0.01
R3973:Lrpprc	UTSW	17	84770841	critical splice donor site	probably null
R4111:Lrpprc	UTSW	17	84726338	missense	probably benign	0.00
R4164:Lrpprc	UTSW	17	84731189	missense	possibly damaging	0.47
R4331:Lrpprc	UTSW	17	84740542	critical splice donor site	probably null
R4531:Lrpprc	UTSW	17	84712787	missense	probably benign	0.01
R4832:Lrpprc	UTSW	17	84707156	missense	probably benign	0.24
R4947:Lrpprc	UTSW	17	84771538	missense	probably benign	0.02
R5134:Lrpprc	UTSW	17	84751256	missense	probably benign	0.00
R5333:Lrpprc	UTSW	17	84790393	missense	probably benign	0.01
R5950:Lrpprc	UTSW	17	84740170	missense	possibly damaging	0.86
R5972:Lrpprc	UTSW	17	84712822	missense	possibly damaging	0.88
R6185:Lrpprc	UTSW	17	84767024	missense	probably benign
R6488:Lrpprc	UTSW	17	84751353	missense	probably damaging	1.00
R6807:Lrpprc	UTSW	17	84749103	missense	possibly damaging	0.93
R6911:Lrpprc	UTSW	17	84756283	missense	possibly damaging	0.67
R6933:Lrpprc	UTSW	17	84722703	missense	probably benign	0.42
R6955:Lrpprc	UTSW	17	84776989	missense	probably damaging	0.98
R7448:Lrpprc	UTSW	17	84772139	missense	probably damaging	0.99
R7727:Lrpprc	UTSW	17	84776947	missense	probably benign	0.00
R8003:Lrpprc	UTSW	17	84752317	missense	probably benign	0.01
R8178:Lrpprc	UTSW	17	84772147	missense	probably damaging	1.00
R8310:Lrpprc	UTSW	17	84773096	missense	probably damaging	1.00
R8322:Lrpprc	UTSW	17	84740068	critical splice donor site	probably null
R8389:Lrpprc	UTSW	17	84773314	missense	possibly damaging	0.79
R8560:Lrpprc	UTSW	17	84740067	splice site	probably benign
R8777:Lrpprc	UTSW	17	84751229	missense	probably benign	0.30
R8777-TAIL:Lrpprc	UTSW	17	84751229	missense	probably benign	0.30
R8868:Lrpprc	UTSW	17	84771492	missense	probably damaging	0.99
R8970:Lrpprc	UTSW	17	84767055	missense	probably damaging	1.00
R9042:Lrpprc	UTSW	17	84752308	critical splice donor site	probably null
R9493:Lrpprc	UTSW	17	84708120	missense	probably damaging	0.99
R9664:Lrpprc	UTSW	17	84712834	missense	probably damaging	0.99
X0026:Lrpprc	UTSW	17	84710662	missense	probably benign	0.42
Z1088:Lrpprc	UTSW	17	84731784	nonsense	probably null
Z1088:Lrpprc	UTSW	17	84770500	critical splice acceptor site	probably null
Z1176:Lrpprc	UTSW	17	84770431	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- GCCAGAGGCTTCTTCAATACTC -3'
(R):5'- ACAGAAAGGCTTGTTCTGGG -3'

Sequencing Primer
(F):5'- CAGAGGCTTCTTCAATACTCAGAAG -3'
(R):5'- TCTGGGTTCTCTACTTGAAAATAGG -3'

Posted On

2018-03-15