Incidental Mutation 'R6257:Erbb4'
ID506367
Institutional Source Beutler Lab
Gene Symbol Erbb4
Ensembl Gene ENSMUSG00000062209
Gene Nameerb-b2 receptor tyrosine kinase 4
SynonymsHer4, ErbB4
MMRRC Submission 044374-MU
Accession Numbers

Ncbi RefSeq: NM_010154.1; MGI:104771

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6257 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location68032186-69108059 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 68396273 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 155 (L155Q)
Ref Sequence ENSEMBL: ENSMUSP00000115373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119142] [ENSMUST00000121473] [ENSMUST00000153432]
Predicted Effect probably damaging
Transcript: ENSMUST00000119142
AA Change: L155Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112713
Gene: ENSMUSG00000062209
AA Change: L155Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 5e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 1e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121473
AA Change: L155Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114123
Gene: ENSMUSG00000062209
AA Change: L155Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.6e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.5e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153432
AA Change: L155Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115373
Gene: ENSMUSG00000062209
AA Change: L155Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.7e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.7e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 649 2.98e0 SMART
PDB:2R4B|B 680 732 1e-25 PDB
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency 97% (74/76)
MGI Phenotype Strain: 1929607
Lethality: E10-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tyr protein kinase family and the epidermal growth factor receptor subfamily. It encodes a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The protein binds to and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation. Multiple proteolytic events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit cardiac defects, alterations in hindbrain development, and midgestational lethality. Heterozygotes show schizophrenia-like behavior. Genetically rescued females show mammary defects. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(6) Gene trapped(1)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 A T 17: 35,961,182 N313K probably benign Het
Adamts2 T C 11: 50,775,326 V383A probably damaging Het
Adamts6 A T 13: 104,462,282 Q877L probably benign Het
Adgre4 C T 17: 55,802,133 T380I possibly damaging Het
Aspm A G 1: 139,482,053 probably null Het
Atg16l2 A G 7: 101,301,895 probably null Het
Bcl6b C T 11: 70,226,052 R467H probably benign Het
Cacna2d4 G A 6: 119,281,619 probably null Het
Casp8ap2 A G 4: 32,641,364 D806G possibly damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Ccser1 A G 6: 61,373,962 D501G probably damaging Het
Ccser1 A G 6: 62,379,785 T736A probably benign Het
Cd164l2 T A 4: 133,221,034 C19S unknown Het
Cdk15 G A 1: 59,257,105 probably null Het
Cebpz T C 17: 78,935,832 E131G probably benign Het
Ces1d T C 8: 93,166,397 D519G probably benign Het
Cftr A C 6: 18,282,501 T1067P probably benign Het
Chd1 T G 17: 15,730,203 probably null Het
Chil4 T A 3: 106,204,096 D234V possibly damaging Het
Cldn16 T A 16: 26,481,330 S173T probably damaging Het
Cpd A T 11: 76,812,670 F456I probably benign Het
Cst8 C A 2: 148,805,445 A125E probably damaging Het
Dars2 G T 1: 161,041,828 P617Q probably damaging Het
Defb26 A G 2: 152,507,940 V140A unknown Het
Dntt T G 19: 41,053,062 V395G probably damaging Het
Dock10 G A 1: 80,503,696 probably benign Het
Dscam T C 16: 96,673,714 N1216S possibly damaging Het
En1 A T 1: 120,603,907 D292V unknown Het
Erbin T C 13: 103,862,288 T197A probably benign Het
Fat2 A G 11: 55,262,581 F3602L probably benign Het
Fuk A T 8: 110,890,545 C365S probably benign Het
Gm3443 A T 19: 21,555,711 D13V unknown Het
Gm6401 T C 14: 41,967,871 Q10R probably benign Het
Gmcl1 G A 6: 86,700,641 T410I possibly damaging Het
Grid2ip G A 5: 143,380,429 S379N probably damaging Het
H2-T24 T A 17: 36,014,682 T305S probably benign Het
Ksr2 A T 5: 117,414,844 M6L probably benign Het
Lama2 A G 10: 26,986,899 L2956S possibly damaging Het
Lhfpl3 A G 5: 22,746,559 T123A probably benign Het
Lrp1b T A 2: 40,596,969 probably null Het
Ltn1 G A 16: 87,411,774 A812V possibly damaging Het
Maml2 C T 9: 13,620,426 S312L probably damaging Het
Myo7b T A 18: 32,013,415 N106Y probably damaging Het
Nacc2 A T 2: 26,060,408 C439S probably damaging Het
Ncoa7 A G 10: 30,694,177 I224T probably damaging Het
Nf1 A T 11: 79,549,491 L2303F probably damaging Het
Noc3l A T 19: 38,795,905 probably null Het
Nup155 C T 15: 8,150,798 R1120* probably null Het
Oas3 C A 5: 120,761,135 probably benign Het
Ocln T C 13: 100,539,509 I159V probably benign Het
Olfr315 T A 11: 58,779,003 V292E probably damaging Het
Olfr406 T C 11: 74,270,007 V206A probably damaging Het
Os9 A C 10: 127,119,137 C181G probably damaging Het
Phldb1 C T 9: 44,696,140 R1256Q probably damaging Het
Pkd1l1 G A 11: 8,942,195 T208I probably benign Het
Plppr4 T C 3: 117,322,579 Q485R possibly damaging Het
Prkcb T A 7: 122,568,163 D365E probably benign Het
Ptprz1 T A 6: 22,959,640 N45K probably damaging Het
Rbl2 T C 8: 91,115,678 L987P probably damaging Het
Runx1 T A 16: 92,695,911 probably benign Het
Sept4 C A 11: 87,590,349 Q372K probably benign Het
Slc24a4 A G 12: 102,254,510 E400G probably benign Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Sri T A 5: 8,059,596 probably null Het
St3gal3 C T 4: 118,107,678 probably benign Het
Tfpt A T 7: 3,629,567 L3* probably null Het
Tgfb3 T C 12: 86,077,841 D31G possibly damaging Het
Thsd7a G T 6: 12,408,988 C678* probably null Het
Tmbim1 A G 1: 74,293,066 Y101H probably damaging Het
Tmem17 A G 11: 22,512,297 probably benign Het
Tmprss15 A T 16: 78,972,225 V769E probably damaging Het
Trak1 C T 9: 121,446,755 R175C probably damaging Het
Trak1 G T 9: 121,367,224 V41F possibly damaging Het
Trim30c T C 7: 104,390,168 Y140C probably damaging Het
Tubgcp3 A T 8: 12,649,835 probably null Het
Ubr7 T A 12: 102,765,840 C158* probably null Het
Vmn2r79 A T 7: 87,002,570 L392F probably benign Het
Zfp536 T A 7: 37,480,405 D925V probably damaging Het
Other mutations in Erbb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Erbb4 APN 1 68071630 nonsense probably null
IGL01020:Erbb4 APN 1 68298449 splice site probably benign
IGL01349:Erbb4 APN 1 68346593 missense probably benign 0.00
IGL01386:Erbb4 APN 1 68343931 missense probably damaging 1.00
IGL01516:Erbb4 APN 1 68328245 nonsense probably null
IGL01536:Erbb4 APN 1 68290282 missense probably benign 0.00
IGL01721:Erbb4 APN 1 68254563 missense possibly damaging 0.46
IGL01832:Erbb4 APN 1 68254566 missense possibly damaging 0.84
IGL02002:Erbb4 APN 1 68080726 missense probably damaging 1.00
IGL02040:Erbb4 APN 1 68042535 missense probably damaging 1.00
IGL02371:Erbb4 APN 1 68290294 missense probably benign 0.00
IGL02399:Erbb4 APN 1 68042437 splice site probably benign
IGL02553:Erbb4 APN 1 68305864 missense probably benign 0.17
IGL03118:Erbb4 APN 1 68042719 missense probably benign 0.11
IGL03329:Erbb4 APN 1 68328122 missense probably benign 0.30
IGL03405:Erbb4 APN 1 68330238 missense probably benign 0.02
excrescence UTSW 1 68330246 missense probably damaging 1.00
Mole UTSW 1 68560576 missense probably damaging 1.00
tag UTSW 1 68250580 missense possibly damaging 0.67
P0018:Erbb4 UTSW 1 68071676 missense probably benign 0.05
PIT4480001:Erbb4 UTSW 1 68075543 missense probably damaging 1.00
R0193:Erbb4 UTSW 1 68043960 intron probably benign
R0329:Erbb4 UTSW 1 68298280 splice site probably benign
R0335:Erbb4 UTSW 1 68259259 missense probably benign
R0362:Erbb4 UTSW 1 68330270 missense probably damaging 0.99
R0579:Erbb4 UTSW 1 68042462 missense probably benign 0.17
R0730:Erbb4 UTSW 1 68259290 missense probably damaging 0.98
R1029:Erbb4 UTSW 1 68309614 missense probably damaging 0.96
R1444:Erbb4 UTSW 1 68254600 missense probably damaging 1.00
R1469:Erbb4 UTSW 1 68560682 missense probably damaging 0.99
R1469:Erbb4 UTSW 1 68560682 missense probably damaging 0.99
R1503:Erbb4 UTSW 1 68346546 missense probably benign 0.00
R1523:Erbb4 UTSW 1 68396252 missense possibly damaging 0.95
R1528:Erbb4 UTSW 1 68078582 nonsense probably null
R1604:Erbb4 UTSW 1 68346569 missense possibly damaging 0.88
R1611:Erbb4 UTSW 1 68040388 missense probably damaging 1.00
R1642:Erbb4 UTSW 1 68331234 missense probably damaging 1.00
R1905:Erbb4 UTSW 1 68075410 splice site probably benign
R1929:Erbb4 UTSW 1 68198888 missense probably damaging 0.98
R2046:Erbb4 UTSW 1 68298323 missense probably benign 0.02
R2139:Erbb4 UTSW 1 68346629 missense probably damaging 0.96
R2271:Erbb4 UTSW 1 68198888 missense probably damaging 0.98
R2298:Erbb4 UTSW 1 68042531 missense probably damaging 1.00
R2356:Erbb4 UTSW 1 68078596 missense probably benign 0.00
R3821:Erbb4 UTSW 1 68305913 missense probably damaging 0.97
R4007:Erbb4 UTSW 1 68740401 missense probably damaging 1.00
R4012:Erbb4 UTSW 1 68560576 missense probably damaging 1.00
R4077:Erbb4 UTSW 1 68040337 missense probably benign 0.07
R4196:Erbb4 UTSW 1 68343855 missense possibly damaging 0.90
R4536:Erbb4 UTSW 1 68346622 missense probably damaging 1.00
R4561:Erbb4 UTSW 1 68343921 nonsense probably null
R4642:Erbb4 UTSW 1 68250632 missense probably damaging 1.00
R4737:Erbb4 UTSW 1 68343900 missense probably damaging 0.98
R4739:Erbb4 UTSW 1 68343900 missense probably damaging 0.98
R4780:Erbb4 UTSW 1 68298314 missense probably damaging 1.00
R4801:Erbb4 UTSW 1 68330246 missense probably damaging 1.00
R4802:Erbb4 UTSW 1 68330246 missense probably damaging 1.00
R4811:Erbb4 UTSW 1 68254544 missense probably damaging 1.00
R4832:Erbb4 UTSW 1 68330238 missense probably benign 0.02
R5068:Erbb4 UTSW 1 68043902 splice site probably null
R5546:Erbb4 UTSW 1 68298293 missense probably damaging 0.99
R5755:Erbb4 UTSW 1 68560519 missense possibly damaging 0.96
R6189:Erbb4 UTSW 1 68043916 missense probably benign
R6276:Erbb4 UTSW 1 68560576 missense probably damaging 1.00
R6521:Erbb4 UTSW 1 68042530 missense probably damaging 1.00
R6602:Erbb4 UTSW 1 68370503 missense probably damaging 0.99
R6808:Erbb4 UTSW 1 68040303 missense probably benign 0.00
R7087:Erbb4 UTSW 1 68740491 missense probably null 1.00
R7215:Erbb4 UTSW 1 68339460 missense probably benign
R7356:Erbb4 UTSW 1 68339355 critical splice donor site probably null
R7509:Erbb4 UTSW 1 68250580 missense possibly damaging 0.67
R7593:Erbb4 UTSW 1 68254599 missense probably damaging 0.99
R7743:Erbb4 UTSW 1 68328119 missense probably benign 0.00
R7784:Erbb4 UTSW 1 68075499 missense probably damaging 1.00
R7815:Erbb4 UTSW 1 68042726 missense probably damaging 1.00
X0019:Erbb4 UTSW 1 68073145 missense probably benign 0.00
Z1176:Erbb4 UTSW 1 68298402 frame shift probably null
Z1176:Erbb4 UTSW 1 68328259 nonsense probably null
Z1177:Erbb4 UTSW 1 68259183 frame shift probably null
Z1177:Erbb4 UTSW 1 68290476 missense probably damaging 1.00
Z1177:Erbb4 UTSW 1 68309643 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GTGGCATGCTGAACAAGTTG -3'
(R):5'- CAACCTCTTCAAGTGTTATAGGC -3'

Sequencing Primer
(F):5'- CCATTCCCTATATGCTGGATGAAGAG -3'
(R):5'- CCTCTTCAAGTGTTATAGGCAAGTG -3'
Posted On2018-03-15