Incidental Mutation 'R6257:Casp8ap2'
ID506378
Institutional Source Beutler Lab
Gene Symbol Casp8ap2
Ensembl Gene ENSMUSG00000028282
Gene Namecaspase 8 associated protein 2
SynonymsFLASH, D4Ertd659e
MMRRC Submission 044374-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6257 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location32615451-32653265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32641364 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 806 (D806G)
Ref Sequence ENSEMBL: ENSMUSP00000136016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029950] [ENSMUST00000108178] [ENSMUST00000178925]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029950
AA Change: D806G

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029950
Gene: ENSMUSG00000028282
AA Change: D806G

DomainStartEndE-ValueType
coiled coil region 68 142 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 458 477 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1250 1268 N/A INTRINSIC
low complexity region 1360 1377 N/A INTRINSIC
low complexity region 1458 1470 N/A INTRINSIC
low complexity region 1477 1498 N/A INTRINSIC
low complexity region 1882 1895 N/A INTRINSIC
PDB:2LR8|A 1896 1962 1e-31 PDB
Blast:SANT 1905 1955 2e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000108178
SMART Domains Protein: ENSMUSP00000103813
Gene: ENSMUSG00000028282

DomainStartEndE-ValueType
PDB:2LR8|A 126 190 4e-26 PDB
Blast:SANT 139 183 4e-19 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127619
Predicted Effect possibly damaging
Transcript: ENSMUST00000178925
AA Change: D806G

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000136016
Gene: ENSMUSG00000028282
AA Change: D806G

DomainStartEndE-ValueType
coiled coil region 68 142 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 458 477 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1250 1268 N/A INTRINSIC
low complexity region 1360 1377 N/A INTRINSIC
low complexity region 1458 1470 N/A INTRINSIC
low complexity region 1477 1498 N/A INTRINSIC
low complexity region 1882 1895 N/A INTRINSIC
PDB:2LR8|A 1896 1962 1e-31 PDB
Blast:SANT 1905 1955 2e-21 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein is highly similar to FLASH, a mouse apoptotic protein identified by its interaction with the death-effector domain (DED) of caspase 8. Studies of FLASH protein suggested that this protein may be a component of the death-inducing signaling complex that includes Fas receptor, Fas-binding adapter FADD, and caspase 8, and plays a regulatory role in Fas-mediated apoptosis. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for disruption of this gene die before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 A T 17: 35,961,182 N313K probably benign Het
Adamts2 T C 11: 50,775,326 V383A probably damaging Het
Adamts6 A T 13: 104,462,282 Q877L probably benign Het
Adgre4 C T 17: 55,802,133 T380I possibly damaging Het
Aspm A G 1: 139,482,053 probably null Het
Atg16l2 A G 7: 101,301,895 probably null Het
Bcl6b C T 11: 70,226,052 R467H probably benign Het
Cacna2d4 G A 6: 119,281,619 probably null Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Ccser1 A G 6: 61,373,962 D501G probably damaging Het
Ccser1 A G 6: 62,379,785 T736A probably benign Het
Cd164l2 T A 4: 133,221,034 C19S unknown Het
Cdk15 G A 1: 59,257,105 probably null Het
Cebpz T C 17: 78,935,832 E131G probably benign Het
Ces1d T C 8: 93,166,397 D519G probably benign Het
Cftr A C 6: 18,282,501 T1067P probably benign Het
Chd1 T G 17: 15,730,203 probably null Het
Chil4 T A 3: 106,204,096 D234V possibly damaging Het
Cldn16 T A 16: 26,481,330 S173T probably damaging Het
Cpd A T 11: 76,812,670 F456I probably benign Het
Cst8 C A 2: 148,805,445 A125E probably damaging Het
Dars2 G T 1: 161,041,828 P617Q probably damaging Het
Defb26 A G 2: 152,507,940 V140A unknown Het
Dntt T G 19: 41,053,062 V395G probably damaging Het
Dock10 G A 1: 80,503,696 probably benign Het
Dscam T C 16: 96,673,714 N1216S possibly damaging Het
En1 A T 1: 120,603,907 D292V unknown Het
Erbb4 A T 1: 68,396,273 L155Q probably damaging Het
Erbin T C 13: 103,862,288 T197A probably benign Het
Fat2 A G 11: 55,262,581 F3602L probably benign Het
Fuk A T 8: 110,890,545 C365S probably benign Het
Gm3443 A T 19: 21,555,711 D13V unknown Het
Gm6401 T C 14: 41,967,871 Q10R probably benign Het
Gmcl1 G A 6: 86,700,641 T410I possibly damaging Het
Grid2ip G A 5: 143,380,429 S379N probably damaging Het
H2-T24 T A 17: 36,014,682 T305S probably benign Het
Ksr2 A T 5: 117,414,844 M6L probably benign Het
Lama2 A G 10: 26,986,899 L2956S possibly damaging Het
Lhfpl3 A G 5: 22,746,559 T123A probably benign Het
Lrp1b T A 2: 40,596,969 probably null Het
Ltn1 G A 16: 87,411,774 A812V possibly damaging Het
Maml2 C T 9: 13,620,426 S312L probably damaging Het
Myo7b T A 18: 32,013,415 N106Y probably damaging Het
Nacc2 A T 2: 26,060,408 C439S probably damaging Het
Ncoa7 A G 10: 30,694,177 I224T probably damaging Het
Nf1 A T 11: 79,549,491 L2303F probably damaging Het
Noc3l A T 19: 38,795,905 probably null Het
Nup155 C T 15: 8,150,798 R1120* probably null Het
Oas3 C A 5: 120,761,135 probably benign Het
Ocln T C 13: 100,539,509 I159V probably benign Het
Olfr315 T A 11: 58,779,003 V292E probably damaging Het
Olfr406 T C 11: 74,270,007 V206A probably damaging Het
Os9 A C 10: 127,119,137 C181G probably damaging Het
Phldb1 C T 9: 44,696,140 R1256Q probably damaging Het
Pkd1l1 G A 11: 8,942,195 T208I probably benign Het
Plppr4 T C 3: 117,322,579 Q485R possibly damaging Het
Prkcb T A 7: 122,568,163 D365E probably benign Het
Ptprz1 T A 6: 22,959,640 N45K probably damaging Het
Rbl2 T C 8: 91,115,678 L987P probably damaging Het
Runx1 T A 16: 92,695,911 probably benign Het
Sept4 C A 11: 87,590,349 Q372K probably benign Het
Slc24a4 A G 12: 102,254,510 E400G probably benign Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Sri T A 5: 8,059,596 probably null Het
St3gal3 C T 4: 118,107,678 probably benign Het
Tfpt A T 7: 3,629,567 L3* probably null Het
Tgfb3 T C 12: 86,077,841 D31G possibly damaging Het
Thsd7a G T 6: 12,408,988 C678* probably null Het
Tmbim1 A G 1: 74,293,066 Y101H probably damaging Het
Tmem17 A G 11: 22,512,297 probably benign Het
Tmprss15 A T 16: 78,972,225 V769E probably damaging Het
Trak1 C T 9: 121,446,755 R175C probably damaging Het
Trak1 G T 9: 121,367,224 V41F possibly damaging Het
Trim30c T C 7: 104,390,168 Y140C probably damaging Het
Tubgcp3 A T 8: 12,649,835 probably null Het
Ubr7 T A 12: 102,765,840 C158* probably null Het
Vmn2r79 A T 7: 87,002,570 L392F probably benign Het
Zfp536 T A 7: 37,480,405 D925V probably damaging Het
Other mutations in Casp8ap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00686:Casp8ap2 APN 4 32641433 missense probably damaging 1.00
IGL00714:Casp8ap2 APN 4 32649192 missense probably damaging 1.00
IGL00754:Casp8ap2 APN 4 32641036 missense probably benign 0.00
IGL00954:Casp8ap2 APN 4 32645403 missense probably damaging 1.00
IGL00970:Casp8ap2 APN 4 32646182 missense probably benign
IGL01534:Casp8ap2 APN 4 32648134 splice site probably benign
IGL01596:Casp8ap2 APN 4 32646365 missense probably damaging 1.00
IGL01686:Casp8ap2 APN 4 32641294 missense possibly damaging 0.94
IGL02002:Casp8ap2 APN 4 32639391 missense probably damaging 1.00
IGL02273:Casp8ap2 APN 4 32643974 missense probably damaging 1.00
IGL02510:Casp8ap2 APN 4 32639704 missense probably benign 0.05
IGL02600:Casp8ap2 APN 4 32630246 missense probably null 1.00
IGL02929:Casp8ap2 APN 4 32624105 utr 5 prime probably benign
F5770:Casp8ap2 UTSW 4 32639944 missense probably benign 0.00
IGL02988:Casp8ap2 UTSW 4 32644590 missense probably benign 0.14
R0023:Casp8ap2 UTSW 4 32640185 missense probably damaging 0.99
R0027:Casp8ap2 UTSW 4 32643810 missense probably benign 0.01
R0090:Casp8ap2 UTSW 4 32640327 missense probably damaging 1.00
R0117:Casp8ap2 UTSW 4 32640817 missense probably benign 0.00
R0144:Casp8ap2 UTSW 4 32643797 missense possibly damaging 0.50
R0268:Casp8ap2 UTSW 4 32644079 missense probably damaging 0.99
R0344:Casp8ap2 UTSW 4 32644079 missense probably damaging 0.99
R0555:Casp8ap2 UTSW 4 32640381 missense probably damaging 1.00
R1051:Casp8ap2 UTSW 4 32640790 missense probably benign 0.28
R1165:Casp8ap2 UTSW 4 32640563 missense probably benign 0.01
R1243:Casp8ap2 UTSW 4 32645687 missense probably benign 0.03
R1311:Casp8ap2 UTSW 4 32648111 missense probably damaging 0.98
R1337:Casp8ap2 UTSW 4 32645721 missense possibly damaging 0.64
R1471:Casp8ap2 UTSW 4 32639386 nonsense probably null
R1497:Casp8ap2 UTSW 4 32639938 missense probably benign 0.00
R1521:Casp8ap2 UTSW 4 32631867 missense probably damaging 1.00
R1588:Casp8ap2 UTSW 4 32640541 missense probably benign 0.00
R1625:Casp8ap2 UTSW 4 32648068 missense probably benign 0.04
R1731:Casp8ap2 UTSW 4 32641442 missense possibly damaging 0.94
R1899:Casp8ap2 UTSW 4 32643647 missense probably damaging 0.98
R2000:Casp8ap2 UTSW 4 32634874 missense probably damaging 1.00
R2021:Casp8ap2 UTSW 4 32644560 missense probably benign 0.05
R2022:Casp8ap2 UTSW 4 32644560 missense probably benign 0.05
R2023:Casp8ap2 UTSW 4 32644560 missense probably benign 0.05
R2088:Casp8ap2 UTSW 4 32631126 missense probably damaging 1.00
R2104:Casp8ap2 UTSW 4 32644727 missense probably benign 0.00
R2128:Casp8ap2 UTSW 4 32640142 missense probably benign 0.06
R2129:Casp8ap2 UTSW 4 32640142 missense probably benign 0.06
R2305:Casp8ap2 UTSW 4 32646411 missense probably damaging 1.00
R2316:Casp8ap2 UTSW 4 32643781 missense probably benign 0.31
R2919:Casp8ap2 UTSW 4 32645343 missense probably damaging 1.00
R4091:Casp8ap2 UTSW 4 32643611 missense probably damaging 1.00
R4357:Casp8ap2 UTSW 4 32646150 missense probably benign 0.00
R4807:Casp8ap2 UTSW 4 32644505 missense possibly damaging 0.89
R4828:Casp8ap2 UTSW 4 32639807 missense probably benign
R4908:Casp8ap2 UTSW 4 32639905 missense possibly damaging 0.90
R4945:Casp8ap2 UTSW 4 32631163 missense possibly damaging 0.57
R4962:Casp8ap2 UTSW 4 32640554 missense probably damaging 0.99
R6014:Casp8ap2 UTSW 4 32641400 missense probably damaging 0.97
R6092:Casp8ap2 UTSW 4 32639380 missense probably damaging 1.00
R6289:Casp8ap2 UTSW 4 32639590 missense probably damaging 1.00
R6482:Casp8ap2 UTSW 4 32634813 missense probably damaging 1.00
R6496:Casp8ap2 UTSW 4 32641553 missense probably benign 0.05
R6515:Casp8ap2 UTSW 4 32646423 missense possibly damaging 0.64
R7015:Casp8ap2 UTSW 4 32644278 missense probably damaging 1.00
R7033:Casp8ap2 UTSW 4 32639392 missense probably damaging 1.00
R7072:Casp8ap2 UTSW 4 32644766 missense probably damaging 1.00
R7448:Casp8ap2 UTSW 4 32643974 missense possibly damaging 0.84
R7944:Casp8ap2 UTSW 4 32645909 missense probably benign 0.12
R7945:Casp8ap2 UTSW 4 32645909 missense probably benign 0.12
R8170:Casp8ap2 UTSW 4 32615490 splice site probably benign
R8179:Casp8ap2 UTSW 4 32643939 nonsense probably null
R8207:Casp8ap2 UTSW 4 32646446 missense possibly damaging 0.63
R8263:Casp8ap2 UTSW 4 32644072 missense probably damaging 1.00
R8298:Casp8ap2 UTSW 4 32640429 missense probably benign 0.30
V7580:Casp8ap2 UTSW 4 32639944 missense probably benign 0.00
X0018:Casp8ap2 UTSW 4 32643738 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCTTTCACCAAAAGCAGCTGC -3'
(R):5'- TGCTATCATACAGTGGAATTGCAC -3'

Sequencing Primer
(F):5'- AGTGAGAGCCATCTTGCAC -3'
(R):5'- CAGTGGAATTGCACATGAGCTCTC -3'
Posted On2018-03-15