Mutagenetix > Incidental Mutation

Incidental Mutation 'R6257:Casp8ap2'

506378

Institutional Source

Beutler Lab

Gene Symbol

Casp8ap2

Ensembl Gene

ENSMUSG00000028282

Gene Name

caspase 8 associated protein 2

Synonyms

FLASH, D4Ertd659e

MMRRC Submission

044374-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6257 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

32615451-32653265 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 32641364 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 806 (D806G)

Ref Sequence

ENSEMBL: ENSMUSP00000136016 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029950] [ENSMUST00000108178] [ENSMUST00000178925]

AlphaFold

Q9WUF3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029950
AA Change: D806G

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000029950
Gene: ENSMUSG00000028282
AA Change: D806G

Domain	Start	End	E-Value	Type
coiled coil region	68	142	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	458	477	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1250	1268	N/A	INTRINSIC
low complexity region	1360	1377	N/A	INTRINSIC
low complexity region	1458	1470	N/A	INTRINSIC
low complexity region	1477	1498	N/A	INTRINSIC
low complexity region	1882	1895	N/A	INTRINSIC
PDB:2LR8\|A	1896	1962	1e-31	PDB
Blast:SANT	1905	1955	2e-21	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000108178

SMART Domains

Protein: ENSMUSP00000103813
Gene: ENSMUSG00000028282

Domain	Start	End	E-Value	Type
PDB:2LR8\|A	126	190	4e-26	PDB
Blast:SANT	139	183	4e-19	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127619

Predicted Effect

possibly damaging
Transcript: ENSMUST00000178925
AA Change: D806G

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000136016
Gene: ENSMUSG00000028282
AA Change: D806G

Domain	Start	End	E-Value	Type
coiled coil region	68	142	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	458	477	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1250	1268	N/A	INTRINSIC
low complexity region	1360	1377	N/A	INTRINSIC
low complexity region	1458	1470	N/A	INTRINSIC
low complexity region	1477	1498	N/A	INTRINSIC
low complexity region	1882	1895	N/A	INTRINSIC
PDB:2LR8\|A	1896	1962	1e-31	PDB
Blast:SANT	1905	1955	2e-21	BLAST

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.4%

Validation Efficiency

97% (74/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein is highly similar to FLASH, a mouse apoptotic protein identified by its interaction with the death-effector domain (DED) of caspase 8. Studies of FLASH protein suggested that this protein may be a component of the death-inducing signaling complex that includes Fas receptor, Fas-binding adapter FADD, and caspase 8, and plays a regulatory role in Fas-mediated apoptosis. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for disruption of this gene die before implantation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcf1	A	T	17: 35,961,182	N313K	probably benign	Het
Adamts2	T	C	11: 50,775,326	V383A	probably damaging	Het
Adamts6	A	T	13: 104,462,282	Q877L	probably benign	Het
Adgre4	C	T	17: 55,802,133	T380I	possibly damaging	Het
Aspm	A	G	1: 139,482,053		probably null	Het
Atg16l2	A	G	7: 101,301,895		probably null	Het
Bcl6b	C	T	11: 70,226,052	R467H	probably benign	Het
Cacna2d4	G	A	6: 119,281,619		probably null	Het
Ccdc13	A	G	9: 121,798,909		probably benign	Het
Ccser1	A	G	6: 61,373,962	D501G	probably damaging	Het
Ccser1	A	G	6: 62,379,785	T736A	probably benign	Het
Cd164l2	T	A	4: 133,221,034	C19S	unknown	Het
Cdk15	G	A	1: 59,257,105		probably null	Het
Cebpz	T	C	17: 78,935,832	E131G	probably benign	Het
Ces1d	T	C	8: 93,166,397	D519G	probably benign	Het
Cftr	A	C	6: 18,282,501	T1067P	probably benign	Het
Chd1	T	G	17: 15,730,203		probably null	Het
Chil4	T	A	3: 106,204,096	D234V	possibly damaging	Het
Cldn16	T	A	16: 26,481,330	S173T	probably damaging	Het
Cpd	A	T	11: 76,812,670	F456I	probably benign	Het
Cst8	C	A	2: 148,805,445	A125E	probably damaging	Het
Dars2	G	T	1: 161,041,828	P617Q	probably damaging	Het
Defb26	A	G	2: 152,507,940	V140A	unknown	Het
Dntt	T	G	19: 41,053,062	V395G	probably damaging	Het
Dock10	G	A	1: 80,503,696		probably benign	Het
Dscam	T	C	16: 96,673,714	N1216S	possibly damaging	Het
En1	A	T	1: 120,603,907	D292V	unknown	Het
Erbb4	A	T	1: 68,396,273	L155Q	probably damaging	Het
Erbin	T	C	13: 103,862,288	T197A	probably benign	Het
Fat2	A	G	11: 55,262,581	F3602L	probably benign	Het
Fuk	A	T	8: 110,890,545	C365S	probably benign	Het
Gm3443	A	T	19: 21,555,711	D13V	unknown	Het
Gm6401	T	C	14: 41,967,871	Q10R	probably benign	Het
Gmcl1	G	A	6: 86,700,641	T410I	possibly damaging	Het
Grid2ip	G	A	5: 143,380,429	S379N	probably damaging	Het
H2-T24	T	A	17: 36,014,682	T305S	probably benign	Het
Ksr2	A	T	5: 117,414,844	M6L	probably benign	Het
Lama2	A	G	10: 26,986,899	L2956S	possibly damaging	Het
Lhfpl3	A	G	5: 22,746,559	T123A	probably benign	Het
Lrp1b	T	A	2: 40,596,969		probably null	Het
Ltn1	G	A	16: 87,411,774	A812V	possibly damaging	Het
Maml2	C	T	9: 13,620,426	S312L	probably damaging	Het
Myo7b	T	A	18: 32,013,415	N106Y	probably damaging	Het
Nacc2	A	T	2: 26,060,408	C439S	probably damaging	Het
Ncoa7	A	G	10: 30,694,177	I224T	probably damaging	Het
Nf1	A	T	11: 79,549,491	L2303F	probably damaging	Het
Noc3l	A	T	19: 38,795,905		probably null	Het
Nup155	C	T	15: 8,150,798	R1120*	probably null	Het
Oas3	C	A	5: 120,761,135		probably benign	Het
Ocln	T	C	13: 100,539,509	I159V	probably benign	Het
Olfr315	T	A	11: 58,779,003	V292E	probably damaging	Het
Olfr406	T	C	11: 74,270,007	V206A	probably damaging	Het
Os9	A	C	10: 127,119,137	C181G	probably damaging	Het
Phldb1	C	T	9: 44,696,140	R1256Q	probably damaging	Het
Pkd1l1	G	A	11: 8,942,195	T208I	probably benign	Het
Plppr4	T	C	3: 117,322,579	Q485R	possibly damaging	Het
Prkcb	T	A	7: 122,568,163	D365E	probably benign	Het
Ptprz1	T	A	6: 22,959,640	N45K	probably damaging	Het
Rbl2	T	C	8: 91,115,678	L987P	probably damaging	Het
Runx1	T	A	16: 92,695,911		probably benign	Het
Sept4	C	A	11: 87,590,349	Q372K	probably benign	Het
Slc24a4	A	G	12: 102,254,510	E400G	probably benign	Het
Smtnl2	G	A	11: 72,401,399	A274V	probably damaging	Het
Sri	T	A	5: 8,059,596		probably null	Het
St3gal3	C	T	4: 118,107,678		probably benign	Het
Tfpt	A	T	7: 3,629,567	L3*	probably null	Het
Tgfb3	T	C	12: 86,077,841	D31G	possibly damaging	Het
Thsd7a	G	T	6: 12,408,988	C678*	probably null	Het
Tmbim1	A	G	1: 74,293,066	Y101H	probably damaging	Het
Tmem17	A	G	11: 22,512,297		probably benign	Het
Tmprss15	A	T	16: 78,972,225	V769E	probably damaging	Het
Trak1	C	T	9: 121,446,755	R175C	probably damaging	Het
Trak1	G	T	9: 121,367,224	V41F	possibly damaging	Het
Trim30c	T	C	7: 104,390,168	Y140C	probably damaging	Het
Tubgcp3	A	T	8: 12,649,835		probably null	Het
Ubr7	T	A	12: 102,765,840	C158*	probably null	Het
Vmn2r79	A	T	7: 87,002,570	L392F	probably benign	Het
Zfp536	T	A	7: 37,480,405	D925V	probably damaging	Het

Other mutations in Casp8ap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00686:Casp8ap2	APN	4	32641433	missense	probably damaging	1.00
IGL00714:Casp8ap2	APN	4	32649192	missense	probably damaging	1.00
IGL00754:Casp8ap2	APN	4	32641036	missense	probably benign	0.00
IGL00954:Casp8ap2	APN	4	32645403	missense	probably damaging	1.00
IGL00970:Casp8ap2	APN	4	32646182	missense	probably benign
IGL01534:Casp8ap2	APN	4	32648134	splice site	probably benign
IGL01596:Casp8ap2	APN	4	32646365	missense	probably damaging	1.00
IGL01686:Casp8ap2	APN	4	32641294	missense	possibly damaging	0.94
IGL02002:Casp8ap2	APN	4	32639391	missense	probably damaging	1.00
IGL02273:Casp8ap2	APN	4	32643974	missense	probably damaging	1.00
IGL02510:Casp8ap2	APN	4	32639704	missense	probably benign	0.05
IGL02600:Casp8ap2	APN	4	32630246	missense	probably null	1.00
IGL02929:Casp8ap2	APN	4	32624105	utr 5 prime	probably benign
F5770:Casp8ap2	UTSW	4	32639944	missense	probably benign	0.00
IGL02988:Casp8ap2	UTSW	4	32644590	missense	probably benign	0.14
R0023:Casp8ap2	UTSW	4	32640185	missense	probably damaging	0.99
R0027:Casp8ap2	UTSW	4	32643810	missense	probably benign	0.01
R0090:Casp8ap2	UTSW	4	32640327	missense	probably damaging	1.00
R0117:Casp8ap2	UTSW	4	32640817	missense	probably benign	0.00
R0144:Casp8ap2	UTSW	4	32643797	missense	possibly damaging	0.50
R0268:Casp8ap2	UTSW	4	32644079	missense	probably damaging	0.99
R0344:Casp8ap2	UTSW	4	32644079	missense	probably damaging	0.99
R0555:Casp8ap2	UTSW	4	32640381	missense	probably damaging	1.00
R1051:Casp8ap2	UTSW	4	32640790	missense	probably benign	0.28
R1165:Casp8ap2	UTSW	4	32640563	missense	probably benign	0.01
R1243:Casp8ap2	UTSW	4	32645687	missense	probably benign	0.03
R1311:Casp8ap2	UTSW	4	32648111	missense	probably damaging	0.98
R1337:Casp8ap2	UTSW	4	32645721	missense	possibly damaging	0.64
R1471:Casp8ap2	UTSW	4	32639386	nonsense	probably null
R1497:Casp8ap2	UTSW	4	32639938	missense	probably benign	0.00
R1521:Casp8ap2	UTSW	4	32631867	missense	probably damaging	1.00
R1588:Casp8ap2	UTSW	4	32640541	missense	probably benign	0.00
R1625:Casp8ap2	UTSW	4	32648068	missense	probably benign	0.04
R1731:Casp8ap2	UTSW	4	32641442	missense	possibly damaging	0.94
R1899:Casp8ap2	UTSW	4	32643647	missense	probably damaging	0.98
R2000:Casp8ap2	UTSW	4	32634874	missense	probably damaging	1.00
R2021:Casp8ap2	UTSW	4	32644560	missense	probably benign	0.05
R2022:Casp8ap2	UTSW	4	32644560	missense	probably benign	0.05
R2023:Casp8ap2	UTSW	4	32644560	missense	probably benign	0.05
R2088:Casp8ap2	UTSW	4	32631126	missense	probably damaging	1.00
R2104:Casp8ap2	UTSW	4	32644727	missense	probably benign	0.00
R2128:Casp8ap2	UTSW	4	32640142	missense	probably benign	0.06
R2129:Casp8ap2	UTSW	4	32640142	missense	probably benign	0.06
R2305:Casp8ap2	UTSW	4	32646411	missense	probably damaging	1.00
R2316:Casp8ap2	UTSW	4	32643781	missense	probably benign	0.31
R2919:Casp8ap2	UTSW	4	32645343	missense	probably damaging	1.00
R4091:Casp8ap2	UTSW	4	32643611	missense	probably damaging	1.00
R4357:Casp8ap2	UTSW	4	32646150	missense	probably benign	0.00
R4807:Casp8ap2	UTSW	4	32644505	missense	possibly damaging	0.89
R4828:Casp8ap2	UTSW	4	32639807	missense	probably benign
R4908:Casp8ap2	UTSW	4	32639905	missense	possibly damaging	0.90
R4945:Casp8ap2	UTSW	4	32631163	missense	possibly damaging	0.57
R4962:Casp8ap2	UTSW	4	32640554	missense	probably damaging	0.99
R6014:Casp8ap2	UTSW	4	32641400	missense	probably damaging	0.97
R6092:Casp8ap2	UTSW	4	32639380	missense	probably damaging	1.00
R6289:Casp8ap2	UTSW	4	32639590	missense	probably damaging	1.00
R6482:Casp8ap2	UTSW	4	32634813	missense	probably damaging	1.00
R6496:Casp8ap2	UTSW	4	32641553	missense	probably benign	0.05
R6515:Casp8ap2	UTSW	4	32646423	missense	possibly damaging	0.64
R7015:Casp8ap2	UTSW	4	32644278	missense	probably damaging	1.00
R7033:Casp8ap2	UTSW	4	32639392	missense	probably damaging	1.00
R7072:Casp8ap2	UTSW	4	32644766	missense	probably damaging	1.00
R7448:Casp8ap2	UTSW	4	32643974	missense	possibly damaging	0.84
R7944:Casp8ap2	UTSW	4	32645909	missense	probably benign	0.12
R7945:Casp8ap2	UTSW	4	32645909	missense	probably benign	0.12
R8170:Casp8ap2	UTSW	4	32615490	splice site	probably benign
R8179:Casp8ap2	UTSW	4	32643939	nonsense	probably null
R8207:Casp8ap2	UTSW	4	32646446	missense	possibly damaging	0.63
R8263:Casp8ap2	UTSW	4	32644072	missense	probably damaging	1.00
R8298:Casp8ap2	UTSW	4	32640429	missense	probably benign	0.30
R9441:Casp8ap2	UTSW	4	32645873	missense	probably benign	0.00
R9455:Casp8ap2	UTSW	4	32643924	missense	possibly damaging	0.85
R9729:Casp8ap2	UTSW	4	32643807	missense	possibly damaging	0.71
V7580:Casp8ap2	UTSW	4	32639944	missense	probably benign	0.00
X0018:Casp8ap2	UTSW	4	32643738	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TCTTTCACCAAAAGCAGCTGC -3'
(R):5'- TGCTATCATACAGTGGAATTGCAC -3'

Sequencing Primer
(F):5'- AGTGAGAGCCATCTTGCAC -3'
(R):5'- CAGTGGAATTGCACATGAGCTCTC -3'

Posted On

2018-03-15